Mutagenetix > Incidental Mutation

Incidental Mutation 'R5339:Tbx15'

423679

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

042918-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R5339 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99316284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 263 (V263M)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: V263M

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: V263M

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	T	10: 10,442,606	G158E	probably damaging	Het
Adgrl2	C	T	3: 148,817,844	R1256H	probably benign	Het
C3	C	A	17: 57,224,308	V329F	probably damaging	Het
Ccdc50	C	T	16: 27,417,305	H130Y	probably damaging	Het
Chrna7	A	G	7: 63,099,307	S476P	probably damaging	Het
Crtc1	A	T	8: 70,397,733		probably benign	Het
Dnah12	A	G	14: 26,814,537	T2137A	possibly damaging	Het
Ehd3	G	A	17: 73,828,207	M359I	possibly damaging	Het
Fastkd3	G	A	13: 68,590,164	G611R	probably damaging	Het
Foxa2	T	A	2: 148,044,434	S154C	probably damaging	Het
Gfm2	T	C	13: 97,175,040	I733T	probably benign	Het
Gm1968	T	C	16: 29,962,259		noncoding transcript	Het
Gmfg-ps	T	C	6: 4,893,401		noncoding transcript	Het
Gzmd	A	T	14: 56,130,683	N106K	possibly damaging	Het
Huwe1	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	X: 151,907,048		probably benign	Het
Ipo5	T	C	14: 120,943,710	W883R	probably damaging	Het
Itpr1	T	A	6: 108,393,961	V1063D	probably damaging	Het
Kansl3	A	C	1: 36,367,721		probably benign	Het
Klkb1	C	A	8: 45,270,711	V556F	possibly damaging	Het
Krtap14	C	A	16: 88,825,859	R77S	probably benign	Het
Leng8	T	A	7: 4,145,286	Y686N	possibly damaging	Het
Mctp1	C	A	13: 76,825,706		probably benign	Het
Moxd2	T	C	6: 40,885,420	Y155C	probably damaging	Het
Ofcc1	A	G	13: 40,087,845	V729A	probably benign	Het
Olfr1361	G	A	13: 21,659,234	L30F	probably benign	Het
Olfr728	C	A	14: 50,140,302	M112I	probably damaging	Het
Olfr845	G	A	9: 19,339,159	G233E	possibly damaging	Het
Olfr948	A	T	9: 39,319,303	F104I	possibly damaging	Het
Olfr970	T	A	9: 39,819,933	M98K	probably damaging	Het
Pdia4	C	T	6: 47,796,685	A577T	possibly damaging	Het
Pex5	A	T	6: 124,398,004	S629T	probably benign	Het
Pnpla7	T	C	2: 25,002,937	S146P	probably benign	Het
Prune2	G	A	19: 17,120,872	E1247K	probably damaging	Het
Reg3a	A	G	6: 78,383,539		probably null	Het
Snx8	G	A	5: 140,358,150	R78C	probably damaging	Het
Sstr5	T	C	17: 25,491,199	E352G	probably benign	Het
Svep1	T	C	4: 58,121,892	Y767C	possibly damaging	Het
Tdrd9	T	C	12: 112,027,122	Y695H	probably damaging	Het
Tep1	A	T	14: 50,844,574	L1174Q	probably damaging	Het
Tg	T	A	15: 66,678,093	Y235N	probably damaging	Het
Tha1	C	A	11: 117,871,082	R111L	possibly damaging	Het
Trim17	C	T	11: 58,954,510		probably null	Het
Trim72	A	G	7: 128,010,333	T436A	probably benign	Het
Uba7	C	T	9: 107,978,866	A480V	probably damaging	Het
Ublcp1	A	T	11: 44,455,608	S313T	probably benign	Het
Ubqlnl	A	G	7: 104,149,765	V175A	probably benign	Het
Vps26a	A	G	10: 62,458,967	L276P	probably damaging	Het
Zdhhc21	C	T	4: 82,838,313	G110S	probably damaging	Het
Zfp236	T	C	18: 82,624,366	E1133G	probably damaging	Het
Zfp800	A	T	6: 28,256,473	S39T	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAATGCACCCATTTCTAGGCC -3'
(R):5'- TGTGTGTCACTGAGAAGTAAGC -3'

Sequencing Primer
(F):5'- TAATCCATCCAAGTCCTCTAATGC -3'
(R):5'- CTGAGAAGTAAGCATTTCTCGCCAG -3'

Posted On

2016-08-04