Incidental Mutation 'R0487:Sec24c'
ID 42368
Institutional Source Beutler Lab
Gene Symbol Sec24c
Ensembl Gene ENSMUSG00000039367
Gene Name Sec24 related gene family, member C (S. cerevisiae)
Synonyms 2610204K03Rik
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0487 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 20674308-20694852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 20683399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Alanine at position 166 (P166A)
Ref Sequence ENSEMBL: ENSMUSP00000153434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224492] [ENSMUST00000224754] [ENSMUST00000224876] [ENSMUST00000225108]
AlphaFold G3X972
Predicted Effect probably benign
Transcript: ENSMUST00000048657
AA Change: P265A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367
AA Change: P265A

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect probably benign
Transcript: ENSMUST00000223751
AA Change: P166A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224061
Predicted Effect probably benign
Transcript: ENSMUST00000224492
Predicted Effect probably benign
Transcript: ENSMUST00000224754
Predicted Effect probably benign
Transcript: ENSMUST00000224876
Predicted Effect probably benign
Transcript: ENSMUST00000225108
Predicted Effect probably benign
Transcript: ENSMUST00000228545
AA Change: P115A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Sec24c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sec24c APN 14 20693203 missense probably benign 0.03
IGL00574:Sec24c APN 14 20692395 missense probably damaging 0.99
IGL01514:Sec24c APN 14 20682771 missense possibly damaging 0.78
IGL01924:Sec24c APN 14 20689689 missense probably damaging 0.96
IGL02094:Sec24c APN 14 20688402 missense probably damaging 1.00
IGL02677:Sec24c APN 14 20689642 missense probably damaging 0.98
IGL02871:Sec24c APN 14 20692882 missense probably benign
Kahuna UTSW 14 20690773 missense probably damaging 0.99
R0010:Sec24c UTSW 14 20689261 unclassified probably benign
R0335:Sec24c UTSW 14 20688715 splice site probably null
R0609:Sec24c UTSW 14 20686948 missense probably damaging 1.00
R0626:Sec24c UTSW 14 20688437 missense probably damaging 1.00
R0734:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R0854:Sec24c UTSW 14 20689340 missense probably damaging 1.00
R1036:Sec24c UTSW 14 20692897 missense probably benign 0.14
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1702:Sec24c UTSW 14 20686573 missense probably null
R1765:Sec24c UTSW 14 20688854 unclassified probably benign
R1913:Sec24c UTSW 14 20689111 missense probably benign 0.06
R1920:Sec24c UTSW 14 20686887 missense probably damaging 0.99
R2084:Sec24c UTSW 14 20691279 missense probably benign 0.00
R3778:Sec24c UTSW 14 20683307 missense possibly damaging 0.63
R4383:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4385:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4659:Sec24c UTSW 14 20683144 missense probably damaging 0.99
R4798:Sec24c UTSW 14 20693712 missense probably damaging 1.00
R4872:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R5210:Sec24c UTSW 14 20691804 missense probably damaging 1.00
R5345:Sec24c UTSW 14 20693220 missense probably benign 0.00
R5610:Sec24c UTSW 14 20691825 missense probably damaging 1.00
R5614:Sec24c UTSW 14 20682738 missense possibly damaging 0.92
R5646:Sec24c UTSW 14 20679573 missense probably benign 0.01
R6460:Sec24c UTSW 14 20690800 missense probably damaging 1.00
R7181:Sec24c UTSW 14 20689333 missense probably damaging 1.00
R8228:Sec24c UTSW 14 20689907 missense probably benign 0.05
R8512:Sec24c UTSW 14 20690852 missense possibly damaging 0.67
R8679:Sec24c UTSW 14 20692859 missense possibly damaging 0.89
R9340:Sec24c UTSW 14 20679530 missense probably benign 0.00
RF010:Sec24c UTSW 14 20688715 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTGAACCCCAGATGCAGGGACAG -3'
(R):5'- AGTGCCTGAGGAAGCCACTCAAAG -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgttattttgttGG -3'
(R):5'- AGGCCACGCTATCTGAATG -3'
Posted On 2013-05-23