Incidental Mutation 'R5339:Zdhhc21'
ID423682
Institutional Source Beutler Lab
Gene Symbol Zdhhc21
Ensembl Gene ENSMUSG00000028403
Gene Namezinc finger, DHHC domain containing 21
Synonyms9130404H11Rik, D130004H04Rik, dep
MMRRC Submission 042918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5339 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82798738-82859958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82838313 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 110 (G110S)
Ref Sequence ENSEMBL: ENSMUSP00000102859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030110] [ENSMUST00000107239] [ENSMUST00000139401] [ENSMUST00000173741]
Predicted Effect probably damaging
Transcript: ENSMUST00000030110
AA Change: G110S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030110
Gene: ENSMUSG00000028403
AA Change: G110S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 217 5.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107239
AA Change: G110S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102859
Gene: ENSMUSG00000028403
AA Change: G110S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 65 N/A INTRINSIC
Pfam:zf-DHHC 85 218 3.6e-34 PFAM
Predicted Effect silent
Transcript: ENSMUST00000139401
SMART Domains Protein: ENSMUSP00000121954
Gene: ENSMUSG00000028403

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 110 3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144139
Predicted Effect probably damaging
Transcript: ENSMUST00000173741
AA Change: G110S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133630
Gene: ENSMUSG00000028403
AA Change: G110S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 125 1.5e-16 PFAM
Meta Mutation Damage Score 0.1339 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype PHENOTYPE: Homozygous mutants of this epidermal acting gene have thin, short hair, many misshapen and disoriented hair follicles, and clumps of pigment reflecting remains of degenerating follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,606 G158E probably damaging Het
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Crtc1 A T 8: 70,397,733 probably benign Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Fastkd3 G A 13: 68,590,164 G611R probably damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Itpr1 T A 6: 108,393,961 V1063D probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Sstr5 T C 17: 25,491,199 E352G probably benign Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Zdhhc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Zdhhc21 APN 4 82844190 missense probably benign 0.43
IGL03172:Zdhhc21 APN 4 82806327 utr 3 prime probably benign
R4393:Zdhhc21 UTSW 4 82847654 missense possibly damaging 0.90
R4701:Zdhhc21 UTSW 4 82820334 missense possibly damaging 0.92
R4910:Zdhhc21 UTSW 4 82820331 missense possibly damaging 0.68
R5288:Zdhhc21 UTSW 4 82847692 missense probably damaging 1.00
R6363:Zdhhc21 UTSW 4 82847674 missense probably damaging 1.00
R8435:Zdhhc21 UTSW 4 82835477 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCTTAGTCCTTCTGTGG -3'
(R):5'- AGAGAAATGTCACCCTGTGG -3'

Sequencing Primer
(F):5'- CTGCTCAAAGTTTTTGCTCAAGTG -3'
(R):5'- CACCCTGTGGAATTTAGTAGCAG -3'
Posted On2016-08-04