Incidental Mutation 'R5339:Itpr1'
ID423690
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission 042918-MU
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R5339 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108393961 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1063 (V1063D)
Ref Sequence ENSEMBL: ENSMUSP00000144880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
Predicted Effect probably damaging
Transcript: ENSMUST00000032192
AA Change: V1063D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V1063D

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203615
AA Change: V1063D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V1063D

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203995
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,606 G158E probably damaging Het
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Crtc1 A T 8: 70,397,733 probably benign Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Fastkd3 G A 13: 68,590,164 G611R probably damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Sstr5 T C 17: 25,491,199 E352G probably benign Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zdhhc21 C T 4: 82,838,313 G110S probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108438331 missense probably benign 0.28
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7502:Itpr1 UTSW 6 108383678 missense probably benign 0.00
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108523405 missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108438360 missense probably benign 0.18
R8200:Itpr1 UTSW 6 108394865 missense probably benign 0.00
R8242:Itpr1 UTSW 6 108386697 missense probably benign 0.44
R8322:Itpr1 UTSW 6 108388229 missense probably benign 0.05
R8377:Itpr1 UTSW 6 108510738 missense probably benign 0.00
R8412:Itpr1 UTSW 6 108363620 missense probably benign 0.07
R8443:Itpr1 UTSW 6 108519348 missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108393967 missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108523366 missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108377802 missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108388211 missense probably damaging 1.00
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTATAACATCGTACTTGTCCCCTC -3'
(R):5'- TCCTTTCATTGCACACAACAGC -3'

Sequencing Primer
(F):5'- AGCAGCGAGGCTCCATTG -3'
(R):5'- GCTTTTTGATACACAATGGCCATGC -3'
Posted On2016-08-04