Incidental Mutation 'R5339:Fastkd3'
ID423711
Institutional Source Beutler Lab
Gene Symbol Fastkd3
Ensembl Gene ENSMUSG00000021532
Gene NameFAST kinase domains 3
Synonyms2310010B21Rik
MMRRC Submission 042918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5339 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location68582234-68592338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68590164 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 611 (G611R)
Ref Sequence ENSEMBL: ENSMUSP00000061737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051784] [ENSMUST00000223319]
Predicted Effect probably damaging
Transcript: ENSMUST00000051784
AA Change: G611R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532
AA Change: G611R

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221006
Predicted Effect unknown
Transcript: ENSMUST00000221640
AA Change: G14R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222068
Predicted Effect probably benign
Transcript: ENSMUST00000222685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223128
Predicted Effect probably benign
Transcript: ENSMUST00000223319
Meta Mutation Damage Score 0.9610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,606 G158E probably damaging Het
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Crtc1 A T 8: 70,397,733 probably benign Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Itpr1 T A 6: 108,393,961 V1063D probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Sstr5 T C 17: 25,491,199 E352G probably benign Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zdhhc21 C T 4: 82,838,313 G110S probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Fastkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Fastkd3 APN 13 68584528 missense possibly damaging 0.87
IGL01839:Fastkd3 APN 13 68584852 missense probably benign 0.19
IGL02268:Fastkd3 APN 13 68583677 missense probably damaging 0.96
IGL03412:Fastkd3 APN 13 68583721 missense probably benign 0.01
R0681:Fastkd3 UTSW 13 68591928 splice site probably benign
R1282:Fastkd3 UTSW 13 68584557 missense possibly damaging 0.76
R1987:Fastkd3 UTSW 13 68585241 missense possibly damaging 0.92
R3081:Fastkd3 UTSW 13 68584868 missense probably benign 0.38
R4153:Fastkd3 UTSW 13 68590138 missense probably damaging 1.00
R5384:Fastkd3 UTSW 13 68584585 missense probably benign 0.09
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6109:Fastkd3 UTSW 13 68590218 nonsense probably null
R6123:Fastkd3 UTSW 13 68590218 nonsense probably null
R6124:Fastkd3 UTSW 13 68590218 nonsense probably null
R6299:Fastkd3 UTSW 13 68587736 missense probably damaging 0.97
R6388:Fastkd3 UTSW 13 68590200 missense probably damaging 1.00
R6561:Fastkd3 UTSW 13 68584030 missense possibly damaging 0.95
R7214:Fastkd3 UTSW 13 68589380 missense probably benign 0.12
R7446:Fastkd3 UTSW 13 68591960 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTTCAACAAACTAAAGGGCAATC -3'
(R):5'- GACAACAGGAAGGCCGTCTG -3'

Sequencing Primer
(F):5'- GGGCAATCTATTCATGATTCCTTTG -3'
(R):5'- GTCGTCAATGGACCATCCTAG -3'
Posted On2016-08-04