Incidental Mutation 'R5339:Sstr5'
ID423723
Institutional Source Beutler Lab
Gene Symbol Sstr5
Ensembl Gene ENSMUSG00000050824
Gene Namesomatostatin receptor 5
SynonymsSmstr5, sst5
MMRRC Submission 042918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5339 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25489875-25497288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25491199 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 352 (E352G)
Ref Sequence ENSEMBL: ENSMUSP00000128787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051864] [ENSMUST00000165183]
Predicted Effect probably benign
Transcript: ENSMUST00000051864
AA Change: E352G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051085
Gene: ENSMUSG00000050824
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.3e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 5.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 3.1e-64 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165183
AA Change: E352G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128787
Gene: ENSMUSG00000050824
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.9e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 3.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 1.9e-71 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for one null allele display decreased numbers of insulin positive cells in the pancreas. Homozygotes for a second null allele have normal pancreatic islet morphology but increased insulin secretion, decreased blood insulin and glucose levels,and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,606 G158E probably damaging Het
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Crtc1 A T 8: 70,397,733 probably benign Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Fastkd3 G A 13: 68,590,164 G611R probably damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Itpr1 T A 6: 108,393,961 V1063D probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zdhhc21 C T 4: 82,838,313 G110S probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Sstr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Sstr5 APN 17 25491331 missense probably damaging 1.00
IGL01738:Sstr5 APN 17 25491610 missense probably damaging 1.00
IGL02212:Sstr5 APN 17 25491673 missense possibly damaging 0.93
IGL03098:Sstr5 UTSW 17 25491277 missense probably benign 0.00
R0402:Sstr5 UTSW 17 25492034 missense probably benign 0.15
R1576:Sstr5 UTSW 17 25491298 missense possibly damaging 0.94
R2354:Sstr5 UTSW 17 25491901 missense probably benign 0.29
R4392:Sstr5 UTSW 17 25491224 missense probably benign
R5469:Sstr5 UTSW 17 25492069 missense probably damaging 1.00
R5865:Sstr5 UTSW 17 25491244 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTAGCAGAACGTTTTGGTGAGAG -3'
(R):5'- TGCCAATAGCTGTGCCAACC -3'

Sequencing Primer
(F):5'- GATGATCAGTCACCCATGGCTTAG -3'
(R):5'- ATAGCTGTGCCAACCCCCTG -3'
Posted On2016-08-04