Incidental Mutation 'R5350:Disp2'
ID423736
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
MMRRC Submission 042929-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118787575 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 201 (T201A)
Ref Sequence ENSEMBL: ENSMUSP00000070031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
Predicted Effect probably benign
Transcript: ENSMUST00000037547
AA Change: T201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
AA Change: T201A

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
AA Change: T201A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
AA Change: T201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 unclassified probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2167:Disp2 UTSW 2 118791685 missense probably damaging 1.00
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5208:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
R7156:Disp2 UTSW 2 118791811 missense probably damaging 1.00
R7230:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R7400:Disp2 UTSW 2 118791886 missense probably damaging 1.00
R7460:Disp2 UTSW 2 118789780 missense probably damaging 1.00
R7505:Disp2 UTSW 2 118791088 missense probably damaging 1.00
R7542:Disp2 UTSW 2 118791118 missense probably damaging 0.97
R7728:Disp2 UTSW 2 118791480 missense probably benign 0.31
R7757:Disp2 UTSW 2 118790910 missense probably damaging 1.00
R7798:Disp2 UTSW 2 118791879 missense probably benign
R8013:Disp2 UTSW 2 118789682 nonsense probably null
R8085:Disp2 UTSW 2 118786971 missense possibly damaging 0.94
R8179:Disp2 UTSW 2 118792549 missense probably damaging 0.99
R8288:Disp2 UTSW 2 118790281 missense probably damaging 1.00
Z1177:Disp2 UTSW 2 118789702 missense probably damaging 0.99
Z1177:Disp2 UTSW 2 118790827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCCCCAGACCCTGAGATG -3'
(R):5'- TGGACCTGCTCATCCTACAG -3'

Sequencing Primer
(F):5'- CTGAGATGAACAGGTAATATGTCCCC -3'
(R):5'- ATCCTACAGGGTGTGGACC -3'
Posted On2016-08-04