Incidental Mutation 'R0487:Cpsf1'
ID42374
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R0487 (G1)
Quality Score181
Status Not validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76597002 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1218 (N1218I)
Ref Sequence ENSEMBL: ENSMUSP00000071794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably damaging
Transcript: ENSMUST00000071898
AA Change: N1218I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: N1218I

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160410
Predicted Effect probably benign
Transcript: ENSMUST00000160784
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161311
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162254
Predicted Effect probably benign
Transcript: ENSMUST00000162503
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229007
Predicted Effect probably damaging
Transcript: ENSMUST00000230157
AA Change: N1218I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229015
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230557
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7612:Cpsf1 UTSW 15 76597009 missense probably benign 0.00
R7739:Cpsf1 UTSW 15 76600311 missense probably benign 0.00
R7878:Cpsf1 UTSW 15 76600500 missense probably damaging 1.00
R8334:Cpsf1 UTSW 15 76603587 missense probably benign 0.26
R8345:Cpsf1 UTSW 15 76601490 missense probably benign
R8382:Cpsf1 UTSW 15 76600951 missense probably benign
R8403:Cpsf1 UTSW 15 76600283 missense probably damaging 0.96
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCATTGTCCACCATGAAGTCCAC -3'
(R):5'- AAAAGTGTGTGACCTCTCCCCTCC -3'

Sequencing Primer
(F):5'- GTATACCTCCAAAGGCTTGGC -3'
(R):5'- cctctcccctcccctcc -3'
Posted On2013-05-23