Incidental Mutation 'R5350:Cops4'
ID423746
Institutional Source Beutler Lab
Gene Symbol Cops4
Ensembl Gene ENSMUSG00000035297
Gene NameCOP9 signalosome subunit 4
SynonymsD5Ertd774e, COP9 complex S4
MMRRC Submission 042929-MU
Accession Numbers

Genbank: NM_012001; MGI: 1349414

Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100518309-100547803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100518539 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 21 (D21E)
Ref Sequence ENSEMBL: ENSMUSP00000115767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045993] [ENSMUST00000123069] [ENSMUST00000146476] [ENSMUST00000151414]
Predicted Effect probably benign
Transcript: ENSMUST00000045993
AA Change: D21E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048416
Gene: ENSMUSG00000035297
AA Change: D21E

DomainStartEndE-ValueType
PINT 295 377 2.09e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123069
AA Change: D21E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000146476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147729
Predicted Effect probably benign
Transcript: ENSMUST00000151414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195972
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Cops4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Cops4 APN 5 100533555 missense probably damaging 1.00
IGL02152:Cops4 APN 5 100533590 missense probably benign 0.20
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0326:Cops4 UTSW 5 100528542 missense probably damaging 0.99
R0494:Cops4 UTSW 5 100528662 missense probably damaging 0.97
R0639:Cops4 UTSW 5 100537460 missense possibly damaging 0.48
R1162:Cops4 UTSW 5 100530157 splice site probably benign
R1400:Cops4 UTSW 5 100533546 missense probably damaging 1.00
R4209:Cops4 UTSW 5 100547486 unclassified probably benign
R4943:Cops4 UTSW 5 100547426 missense probably benign 0.00
R5244:Cops4 UTSW 5 100533375 missense probably benign 0.00
R5855:Cops4 UTSW 5 100547414 missense probably benign
R6010:Cops4 UTSW 5 100543910 missense possibly damaging 0.63
R6026:Cops4 UTSW 5 100542328 unclassified probably benign
R7390:Cops4 UTSW 5 100543875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTCACTCAACTCGGAG -3'
(R):5'- ACTTAAGAAGCTGGCAGCCAC -3'

Sequencing Primer
(F):5'- CGGAGCTAATTCCTGCTCC -3'
(R):5'- GGTCAGGACCCCAGCATAC -3'
Posted On2016-08-04