Incidental Mutation 'R5350:Evi5'
ID423747
Institutional Source Beutler Lab
Gene Symbol Evi5
Ensembl Gene ENSMUSG00000011831
Gene Nameecotropic viral integration site 5
SynonymsNB4S
MMRRC Submission 042929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107744795-107875107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107815678 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 344 (D344N)
Ref Sequence ENSEMBL: ENSMUSP00000114845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112642] [ENSMUST00000124034] [ENSMUST00000128723] [ENSMUST00000138111] [ENSMUST00000155955]
Predicted Effect probably benign
Transcript: ENSMUST00000112642
AA Change: D388N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108261
Gene: ENSMUSG00000011831
AA Change: D388N

DomainStartEndE-ValueType
low complexity region 51 80 N/A INTRINSIC
Blast:TBC 81 157 2e-16 BLAST
TBC 160 371 7.92e-91 SMART
internal_repeat_1 450 477 8.83e-6 PROSPERO
internal_repeat_1 494 521 8.83e-6 PROSPERO
coiled coil region 555 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124034
AA Change: D344N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121761
Gene: ENSMUSG00000011831
AA Change: D344N

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124590
Predicted Effect probably benign
Transcript: ENSMUST00000128723
AA Change: D344N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114845
Gene: ENSMUSG00000011831
AA Change: D344N

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 2e-16 BLAST
TBC 116 327 7.92e-91 SMART
internal_repeat_1 466 493 2.66e-6 PROSPERO
internal_repeat_1 510 537 2.66e-6 PROSPERO
coiled coil region 571 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132482
Predicted Effect probably benign
Transcript: ENSMUST00000138111
AA Change: D344N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119196
Gene: ENSMUSG00000011831
AA Change: D344N

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141673
Predicted Effect probably benign
Transcript: ENSMUST00000155955
SMART Domains Protein: ENSMUSP00000119758
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
Blast:TBC 18 133 3e-20 BLAST
Pfam:RabGAP-TBC 150 222 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Evi5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Evi5 APN 5 107815611 missense probably benign 0.05
IGL01458:Evi5 APN 5 107815647 missense probably damaging 1.00
IGL01615:Evi5 APN 5 107764707 missense probably damaging 1.00
IGL01939:Evi5 APN 5 107816924 unclassified probably benign
IGL02170:Evi5 APN 5 107821884 missense probably benign 0.45
IGL02539:Evi5 APN 5 107815665 missense probably benign 0.09
IGL02655:Evi5 APN 5 107813580 missense probably benign 0.36
IGL03040:Evi5 APN 5 107821806 missense probably damaging 1.00
IGL03058:Evi5 APN 5 107748151 missense probably damaging 0.98
R0125:Evi5 UTSW 5 107795772 missense probably benign 0.06
R0172:Evi5 UTSW 5 107790462 missense probably benign
R0334:Evi5 UTSW 5 107820535 missense probably damaging 0.97
R0335:Evi5 UTSW 5 107812411 missense probably benign 0.06
R0526:Evi5 UTSW 5 107821748 missense probably benign 0.44
R0579:Evi5 UTSW 5 107821709 missense probably benign 0.36
R0585:Evi5 UTSW 5 107813536 unclassified probably benign
R1123:Evi5 UTSW 5 107820578 missense probably benign 0.02
R1618:Evi5 UTSW 5 107799118 splice site probably benign
R1699:Evi5 UTSW 5 107818920 missense probably damaging 1.00
R1772:Evi5 UTSW 5 107795841 missense probably benign 0.32
R1969:Evi5 UTSW 5 107748364 missense probably benign 0.04
R1977:Evi5 UTSW 5 107799139 nonsense probably null
R2010:Evi5 UTSW 5 107813545 critical splice donor site probably null
R3736:Evi5 UTSW 5 107818983 missense probably damaging 0.98
R5047:Evi5 UTSW 5 107821874 missense probably damaging 1.00
R5252:Evi5 UTSW 5 107795752 missense probably benign
R5552:Evi5 UTSW 5 107818989 missense probably damaging 1.00
R5594:Evi5 UTSW 5 107820451 missense possibly damaging 0.84
R5895:Evi5 UTSW 5 107820436 missense probably damaging 1.00
R6334:Evi5 UTSW 5 107820521 nonsense probably null
R6364:Evi5 UTSW 5 107842113 missense probably damaging 1.00
R6838:Evi5 UTSW 5 107842161 missense possibly damaging 0.94
R6861:Evi5 UTSW 5 107748318 missense probably benign 0.00
R7032:Evi5 UTSW 5 107788281 missense probably benign 0.14
R7386:Evi5 UTSW 5 107809823 splice site probably null
R7844:Evi5 UTSW 5 107874994 missense probably benign 0.00
R8248:Evi5 UTSW 5 107818887 critical splice donor site probably null
R8298:Evi5 UTSW 5 107816865 missense possibly damaging 0.53
X0018:Evi5 UTSW 5 107818887 critical splice donor site probably null
X0027:Evi5 UTSW 5 107764762 missense probably damaging 0.98
Z1177:Evi5 UTSW 5 107748379 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTTGTACAGAAGCTAATACTACC -3'
(R):5'- CGAGTAGGATTAGCGCTTCTTC -3'

Sequencing Primer
(F):5'- GAAGTGCCTACATGCTTC -3'
(R):5'- CGCTTCTTCAGATGAATCAGGCAG -3'
Posted On2016-08-04