Incidental Mutation 'R5350:Atg2a'
ID423782
Institutional Source Beutler Lab
Gene Symbol Atg2a
Ensembl Gene ENSMUSG00000024773
Gene Nameautophagy related 2A
Synonyms
MMRRC Submission 042929-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6241668-6262335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6251338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 814 (V814E)
Ref Sequence ENSEMBL: ENSMUSP00000046412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045351]
Predicted Effect probably damaging
Transcript: ENSMUST00000045351
AA Change: V814E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: V814E

DomainStartEndE-ValueType
Pfam:Chorein_N 14 131 7.6e-20 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
low complexity region 852 863 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1761 1773 N/A INTRINSIC
Pfam:ATG_C 1814 1908 2.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135018
Predicted Effect unknown
Transcript: ENSMUST00000145600
AA Change: V615E
SMART Domains Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: V615E

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 871 883 N/A INTRINSIC
low complexity region 1233 1250 N/A INTRINSIC
low complexity region 1565 1577 N/A INTRINSIC
Pfam:ATG_C 1618 1712 3.6e-32 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Atg2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Atg2a APN 19 6254599 missense probably damaging 1.00
IGL01612:Atg2a APN 19 6252484 missense probably benign 0.03
IGL02105:Atg2a APN 19 6250403 splice site probably benign
IGL02151:Atg2a APN 19 6255757 missense possibly damaging 0.95
IGL02228:Atg2a APN 19 6246800 missense probably benign 0.29
IGL02329:Atg2a APN 19 6249929 critical splice donor site probably null
IGL02408:Atg2a APN 19 6241828 nonsense probably null
IGL02538:Atg2a APN 19 6257628 missense probably benign
IGL02830:Atg2a APN 19 6247681 missense probably benign 0.04
IGL03349:Atg2a APN 19 6258024 missense possibly damaging 0.77
PIT4515001:Atg2a UTSW 19 6253585 missense probably damaging 1.00
R0099:Atg2a UTSW 19 6252789 missense probably damaging 0.97
R0212:Atg2a UTSW 19 6246554 missense probably damaging 1.00
R0365:Atg2a UTSW 19 6247683 missense possibly damaging 0.51
R0398:Atg2a UTSW 19 6246578 missense probably damaging 1.00
R0483:Atg2a UTSW 19 6256601 missense probably damaging 0.98
R0483:Atg2a UTSW 19 6256602 missense probably benign 0.01
R0494:Atg2a UTSW 19 6253377 missense probably damaging 1.00
R0511:Atg2a UTSW 19 6252539 missense possibly damaging 0.89
R0590:Atg2a UTSW 19 6245007 unclassified probably benign
R0592:Atg2a UTSW 19 6245007 unclassified probably benign
R0593:Atg2a UTSW 19 6245007 unclassified probably benign
R0630:Atg2a UTSW 19 6244517 missense probably damaging 0.99
R1306:Atg2a UTSW 19 6253021 missense probably benign 0.31
R1437:Atg2a UTSW 19 6250616 missense probably damaging 1.00
R1539:Atg2a UTSW 19 6246771 splice site probably null
R1774:Atg2a UTSW 19 6250598 missense probably benign 0.01
R1781:Atg2a UTSW 19 6256213 missense probably damaging 0.96
R1854:Atg2a UTSW 19 6252431 missense probably benign 0.11
R1884:Atg2a UTSW 19 6254384 missense probably damaging 1.00
R1899:Atg2a UTSW 19 6245067 missense probably damaging 1.00
R1935:Atg2a UTSW 19 6252536 missense probably damaging 1.00
R2020:Atg2a UTSW 19 6250269 critical splice donor site probably null
R2071:Atg2a UTSW 19 6257458 missense probably benign 0.00
R2513:Atg2a UTSW 19 6258046 critical splice donor site probably null
R3808:Atg2a UTSW 19 6252816 missense possibly damaging 0.71
R4065:Atg2a UTSW 19 6258366 missense probably damaging 1.00
R4109:Atg2a UTSW 19 6258374 missense possibly damaging 0.95
R4352:Atg2a UTSW 19 6257457 missense probably benign 0.04
R4440:Atg2a UTSW 19 6255829 critical splice donor site probably null
R4472:Atg2a UTSW 19 6258955 missense probably damaging 0.98
R4669:Atg2a UTSW 19 6258987 critical splice donor site probably null
R4878:Atg2a UTSW 19 6250244 missense probably damaging 1.00
R4926:Atg2a UTSW 19 6257533 missense probably damaging 0.96
R5237:Atg2a UTSW 19 6246814 missense probably benign
R5507:Atg2a UTSW 19 6245070 missense possibly damaging 0.94
R5732:Atg2a UTSW 19 6257460 missense probably damaging 1.00
R5784:Atg2a UTSW 19 6261505 missense probably damaging 1.00
R5960:Atg2a UTSW 19 6254360 missense probably damaging 1.00
R5985:Atg2a UTSW 19 6254637 missense probably damaging 1.00
R6175:Atg2a UTSW 19 6241729 unclassified probably benign
R6572:Atg2a UTSW 19 6254665 missense probably damaging 0.98
R6878:Atg2a UTSW 19 6250178 missense probably damaging 0.99
R6879:Atg2a UTSW 19 6251852 missense possibly damaging 0.70
R6983:Atg2a UTSW 19 6260040 missense probably damaging 0.99
R7024:Atg2a UTSW 19 6250219 missense possibly damaging 0.88
R7217:Atg2a UTSW 19 6253441 critical splice donor site probably null
R7384:Atg2a UTSW 19 6261677 missense probably damaging 1.00
R7387:Atg2a UTSW 19 6255168 missense possibly damaging 0.79
R7425:Atg2a UTSW 19 6255652 missense probably benign 0.02
R7512:Atg2a UTSW 19 6260076 missense probably damaging 1.00
R7658:Atg2a UTSW 19 6251263 missense probably damaging 1.00
R7893:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R8062:Atg2a UTSW 19 6252579 critical splice donor site probably null
R8258:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8259:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8350:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8412:Atg2a UTSW 19 6244524 missense probably damaging 1.00
R8450:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8474:Atg2a UTSW 19 6251403 critical splice donor site probably null
R8501:Atg2a UTSW 19 6254390 missense probably damaging 1.00
R8738:Atg2a UTSW 19 6256644 missense probably benign 0.00
R8786:Atg2a UTSW 19 6244430 missense probably damaging 1.00
R8810:Atg2a UTSW 19 6250621 missense probably benign 0.01
X0065:Atg2a UTSW 19 6258196 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCAATTGCTGTCTTGAAGGC -3'
(R):5'- AGCAGGTCGTTATTGATCCTG -3'

Sequencing Primer
(F):5'- CACATTCATGAAGTCTTTAGGGTAGG -3'
(R):5'- CAGGTCGTTATTGATCCTGACAGG -3'
Posted On2016-08-04