Mutagenetix > Incidental Mutation

Incidental Mutation 'R5350:Atg2a'

423782

Institutional Source

Beutler Lab

Gene Symbol

Atg2a

Ensembl Gene

ENSMUSG00000024773

Gene Name

autophagy related 2A

Synonyms

MMRRC Submission

042929-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R5350 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6241668-6262335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6251338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 814 (V814E)

Ref Sequence

ENSEMBL: ENSMUSP00000046412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045351]

AlphaFold

Q6P4T0

Predicted Effect

probably damaging
Transcript: ENSMUST00000045351
AA Change: V814E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: V814E

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	14	131	7.6e-20	PFAM
low complexity region	138	154	N/A	INTRINSIC
low complexity region	285	301	N/A	INTRINSIC
low complexity region	501	512	N/A	INTRINSIC
low complexity region	852	863	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1761	1773	N/A	INTRINSIC
Pfam:ATG_C	1814	1908	2.2e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135018

Predicted Effect

unknown
Transcript: ENSMUST00000145600
AA Change: V615E

SMART Domains

Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: V615E

Domain	Start	End	E-Value	Type
low complexity region	87	103	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	871	883	N/A	INTRINSIC
low complexity region	1233	1250	N/A	INTRINSIC
low complexity region	1565	1577	N/A	INTRINSIC
Pfam:ATG_C	1618	1712	3.6e-32	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Abca9	A	G	11: 110,115,538	V1247A	probably benign	Het
Acaca	A	T	11: 84,215,873	M133L	probably damaging	Het
Acacb	C	T	5: 114,244,551	A2100V	probably damaging	Het
Adamts16	T	A	13: 70,753,196	K921*	probably null	Het
Ankrd55	T	G	13: 112,336,226	V144G	probably damaging	Het
Arap3	A	G	18: 37,982,035	L976P	probably damaging	Het
Atp2b2	A	T	6: 113,759,238	M960K	probably damaging	Het
Bag1	C	T	4: 40,948,007	G66S	possibly damaging	Het
Bmp8a	A	T	4: 123,313,295	M391K	probably damaging	Het
Capns1	C	A	7: 30,190,126	R216L	probably damaging	Het
Cdk13	T	C	13: 17,803,930		probably benign	Het
Cmtm3	T	C	8: 104,343,833	F75L	probably damaging	Het
Cops4	T	A	5: 100,518,539	D21E	possibly damaging	Het
Dach1	G	T	14: 97,969,959	A318E	probably damaging	Het
Ddx27	A	G	2: 167,027,860		probably benign	Het
Disp2	A	G	2: 118,787,575	T201A	probably benign	Het
Dnah2	G	T	11: 69,516,036	D214E	possibly damaging	Het
Dnah7b	G	T	1: 46,233,689	G2326C	probably benign	Het
Dusp5	T	C	19: 53,541,234	F356S	probably damaging	Het
Duxf3	C	A	10: 58,231,093	S528I	probably damaging	Het
Ell	T	A	8: 70,539,789	V28E	probably damaging	Het
Evi5	C	T	5: 107,815,678	D344N	probably benign	Het
Fv1	G	T	4: 147,870,089	V371L	possibly damaging	Het
Gemin5	A	G	11: 58,141,586		probably null	Het
Glce	A	T	9: 62,060,305	Y521*	probably null	Het
Grn	T	A	11: 102,436,244	L556Q	possibly damaging	Het
Icam1	C	A	9: 21,027,886	Y518*	probably null	Het
Jag2	A	T	12: 112,908,922	S1237R	possibly damaging	Het
Macf1	A	T	4: 123,527,458	M1K	probably null	Het
Nbea	T	C	3: 56,019,424	E786G	probably damaging	Het
Nr4a2	A	G	2: 57,111,865	M192T	probably damaging	Het
Olfr1246	T	A	2: 89,591,088	E9V	possibly damaging	Het
Olfr1396	T	C	11: 49,113,052	T225A	probably benign	Het
Olfr591	T	A	7: 103,173,559	H26L	probably damaging	Het
Olfr860	A	T	9: 19,846,616	M1K	probably null	Het
Pcnx4	A	C	12: 72,579,364	N1115H	probably damaging	Het
Ppargc1b	A	G	18: 61,309,063	S585P	possibly damaging	Het
Ppip5k2	C	T	1: 97,721,128	S1024N	probably damaging	Het
Prkar1b	C	T	5: 139,106,628	E145K	probably damaging	Het
Psd3	T	A	8: 67,908,861	T539S	probably benign	Het
Rit2	A	G	18: 31,316,852	V31A	probably damaging	Het
Rps6kc1	G	A	1: 190,799,466	P780S	probably benign	Het
Serpina6	G	T	12: 103,648,579	T336K	possibly damaging	Het
Smo	A	T	6: 29,754,467	Q232L	probably benign	Het
Stx2	T	C	5: 128,991,091	D184G	probably damaging	Het
Tmprss11d	T	C	5: 86,338,887	Y48C	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het

Other mutations in Atg2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Atg2a	APN	19	6254599	missense	probably damaging	1.00
IGL01612:Atg2a	APN	19	6252484	missense	probably benign	0.03
IGL02105:Atg2a	APN	19	6250403	splice site	probably benign
IGL02151:Atg2a	APN	19	6255757	missense	possibly damaging	0.95
IGL02228:Atg2a	APN	19	6246800	missense	probably benign	0.29
IGL02329:Atg2a	APN	19	6249929	critical splice donor site	probably null
IGL02408:Atg2a	APN	19	6241828	nonsense	probably null
IGL02538:Atg2a	APN	19	6257628	missense	probably benign
IGL02830:Atg2a	APN	19	6247681	missense	probably benign	0.04
IGL03349:Atg2a	APN	19	6258024	missense	possibly damaging	0.77
PIT4515001:Atg2a	UTSW	19	6253585	missense	probably damaging	1.00
R0099:Atg2a	UTSW	19	6252789	missense	probably damaging	0.97
R0212:Atg2a	UTSW	19	6246554	missense	probably damaging	1.00
R0365:Atg2a	UTSW	19	6247683	missense	possibly damaging	0.51
R0398:Atg2a	UTSW	19	6246578	missense	probably damaging	1.00
R0483:Atg2a	UTSW	19	6256601	missense	probably damaging	0.98
R0483:Atg2a	UTSW	19	6256602	missense	probably benign	0.01
R0494:Atg2a	UTSW	19	6253377	missense	probably damaging	1.00
R0511:Atg2a	UTSW	19	6252539	missense	possibly damaging	0.89
R0590:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0592:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0593:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0630:Atg2a	UTSW	19	6244517	missense	probably damaging	0.99
R1306:Atg2a	UTSW	19	6253021	missense	probably benign	0.31
R1437:Atg2a	UTSW	19	6250616	missense	probably damaging	1.00
R1539:Atg2a	UTSW	19	6246771	splice site	probably null
R1774:Atg2a	UTSW	19	6250598	missense	probably benign	0.01
R1781:Atg2a	UTSW	19	6256213	missense	probably damaging	0.96
R1854:Atg2a	UTSW	19	6252431	missense	probably benign	0.11
R1884:Atg2a	UTSW	19	6254384	missense	probably damaging	1.00
R1899:Atg2a	UTSW	19	6245067	missense	probably damaging	1.00
R1935:Atg2a	UTSW	19	6252536	missense	probably damaging	1.00
R2020:Atg2a	UTSW	19	6250269	critical splice donor site	probably null
R2071:Atg2a	UTSW	19	6257458	missense	probably benign	0.00
R2513:Atg2a	UTSW	19	6258046	critical splice donor site	probably null
R3808:Atg2a	UTSW	19	6252816	missense	possibly damaging	0.71
R4065:Atg2a	UTSW	19	6258366	missense	probably damaging	1.00
R4109:Atg2a	UTSW	19	6258374	missense	possibly damaging	0.95
R4352:Atg2a	UTSW	19	6257457	missense	probably benign	0.04
R4440:Atg2a	UTSW	19	6255829	critical splice donor site	probably null
R4472:Atg2a	UTSW	19	6258955	missense	probably damaging	0.98
R4669:Atg2a	UTSW	19	6258987	critical splice donor site	probably null
R4878:Atg2a	UTSW	19	6250244	missense	probably damaging	1.00
R4926:Atg2a	UTSW	19	6257533	missense	probably damaging	0.96
R5237:Atg2a	UTSW	19	6246814	missense	probably benign
R5507:Atg2a	UTSW	19	6245070	missense	possibly damaging	0.94
R5732:Atg2a	UTSW	19	6257460	missense	probably damaging	1.00
R5784:Atg2a	UTSW	19	6261505	missense	probably damaging	1.00
R5960:Atg2a	UTSW	19	6254360	missense	probably damaging	1.00
R5985:Atg2a	UTSW	19	6254637	missense	probably damaging	1.00
R6175:Atg2a	UTSW	19	6241729	unclassified	probably benign
R6572:Atg2a	UTSW	19	6254665	missense	probably damaging	0.98
R6878:Atg2a	UTSW	19	6250178	missense	probably damaging	0.99
R6879:Atg2a	UTSW	19	6251852	missense	possibly damaging	0.70
R6983:Atg2a	UTSW	19	6260040	missense	probably damaging	0.99
R7024:Atg2a	UTSW	19	6250219	missense	possibly damaging	0.88
R7217:Atg2a	UTSW	19	6253441	critical splice donor site	probably null
R7384:Atg2a	UTSW	19	6261677	missense	probably damaging	1.00
R7387:Atg2a	UTSW	19	6255168	missense	possibly damaging	0.79
R7425:Atg2a	UTSW	19	6255652	missense	probably benign	0.02
R7512:Atg2a	UTSW	19	6260076	missense	probably damaging	1.00
R7658:Atg2a	UTSW	19	6251263	missense	probably damaging	1.00
R7893:Atg2a	UTSW	19	6251296	missense	probably damaging	1.00
R8062:Atg2a	UTSW	19	6252579	critical splice donor site	probably null
R8258:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8259:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8350:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8412:Atg2a	UTSW	19	6244524	missense	probably damaging	1.00
R8450:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8474:Atg2a	UTSW	19	6251403	critical splice donor site	probably null
R8501:Atg2a	UTSW	19	6254390	missense	probably damaging	1.00
R8738:Atg2a	UTSW	19	6256644	missense	probably benign	0.00
R8786:Atg2a	UTSW	19	6244430	missense	probably damaging	1.00
R8810:Atg2a	UTSW	19	6250621	missense	probably benign	0.01
R8898:Atg2a	UTSW	19	6256691	splice site	probably benign
R9016:Atg2a	UTSW	19	6250081	missense	probably damaging	1.00
R9111:Atg2a	UTSW	19	6261504	missense	probably damaging	1.00
R9177:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9184:Atg2a	UTSW	19	6241857	missense	probably damaging	1.00
R9268:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9496:Atg2a	UTSW	19	6259992	missense	possibly damaging	0.63
R9570:Atg2a	UTSW	19	6255719	missense	probably benign	0.03
R9642:Atg2a	UTSW	19	6250168	nonsense	probably null
X0065:Atg2a	UTSW	19	6258196	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCAATTGCTGTCTTGAAGGC -3'
(R):5'- AGCAGGTCGTTATTGATCCTG -3'

Sequencing Primer
(F):5'- CACATTCATGAAGTCTTTAGGGTAGG -3'
(R):5'- CAGGTCGTTATTGATCCTGACAGG -3'

Posted On

2016-08-04