Incidental Mutation 'R5351:Olfr1062'
ID423788
Institutional Source Beutler Lab
Gene Symbol Olfr1062
Ensembl Gene ENSMUSG00000090059
Gene Nameolfactory receptor 1062
SynonymsGA_x6K02T2Q125-47892992-47892045, MOR185-1
MMRRC Submission 042930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5351 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86420399-86426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86423266 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 137 (S137P)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
Predicted Effect probably damaging
Transcript: ENSMUST00000105213
AA Change: S137P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: S137P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216166
Predicted Effect probably damaging
Transcript: ENSMUST00000217481
AA Change: S137P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,729,292 S34C probably damaging Het
Apol7e T G 15: 77,718,311 *370G probably null Het
Cacna2d4 T C 6: 119,268,201 I290T probably damaging Het
Ceacam12 T A 7: 18,067,234 V46D probably damaging Het
Ces1d A G 8: 93,178,078 Y345H probably damaging Het
Cirbp T C 10: 80,170,302 probably benign Het
Cnot8 T A 11: 58,115,321 H225Q probably damaging Het
Fstl1 T C 16: 37,829,180 V252A probably damaging Het
H2-T3 T C 17: 36,190,073 Q17R probably benign Het
Htt A G 5: 34,803,833 Y268C probably damaging Het
Ildr2 T C 1: 166,308,909 V439A possibly damaging Het
Lig1 T C 7: 13,300,949 M557T probably damaging Het
Ltbp2 T C 12: 84,790,358 E1229G possibly damaging Het
Mynn C T 3: 30,607,542 R258W probably benign Het
Nbas T A 12: 13,560,849 N2180K probably damaging Het
Pcdh1 C T 18: 38,197,766 G728D probably damaging Het
Pfas T C 11: 68,991,391 D882G probably damaging Het
Prkar2b C T 12: 31,972,127 G60R probably damaging Het
Prkdc G C 16: 15,831,312 V3717L probably benign Het
Prom1 A T 5: 44,044,355 V250E probably damaging Het
Slc35d1 A G 4: 103,189,839 L254P probably damaging Het
Srrt T C 5: 137,298,284 *239W probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A G 2: 76,943,041 V2339A probably damaging Het
Unc80 T A 1: 66,606,513 S1449R possibly damaging Het
Vmn2r24 A T 6: 123,816,264 K850M possibly damaging Het
Zfp516 A G 18: 82,956,751 E358G probably benign Het
Other mutations in Olfr1062
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr1062 APN 2 86422992 missense probably damaging 0.98
IGL02638:Olfr1062 APN 2 86423677 splice site probably null
IGL02863:Olfr1062 APN 2 86423113 missense probably benign 0.44
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R1486:Olfr1062 UTSW 2 86423481 missense probably damaging 0.99
R2327:Olfr1062 UTSW 2 86422821 nonsense probably null
R3695:Olfr1062 UTSW 2 86423643 missense probably damaging 0.96
R3981:Olfr1062 UTSW 2 86422842 missense probably damaging 1.00
R4156:Olfr1062 UTSW 2 86423200 missense possibly damaging 0.67
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R5024:Olfr1062 UTSW 2 86423461 missense possibly damaging 0.77
R5566:Olfr1062 UTSW 2 86423377 nonsense probably null
R5777:Olfr1062 UTSW 2 86423325 missense probably benign 0.00
R6628:Olfr1062 UTSW 2 86423017 missense probably benign 0.02
R7039:Olfr1062 UTSW 2 86422833 missense possibly damaging 0.48
R7159:Olfr1062 UTSW 2 86423612 splice site probably null
R7236:Olfr1062 UTSW 2 86423189 nonsense probably null
R7251:Olfr1062 UTSW 2 86423596 missense probably benign 0.45
R7575:Olfr1062 UTSW 2 86423238 missense probably benign
R7840:Olfr1062 UTSW 2 86423239 missense probably benign 0.00
R8048:Olfr1062 UTSW 2 86423307 missense probably damaging 1.00
R8167:Olfr1062 UTSW 2 86423140 missense probably damaging 1.00
R8465:Olfr1062 UTSW 2 86423631 missense probably benign 0.03
R8672:Olfr1062 UTSW 2 86423632 missense probably benign
R8871:Olfr1062 UTSW 2 86423353 missense probably benign
X0065:Olfr1062 UTSW 2 86423122 missense probably benign 0.39
Z1176:Olfr1062 UTSW 2 86423374 missense probably benign 0.07
Z1177:Olfr1062 UTSW 2 86423253 missense probably damaging 1.00
Z1177:Olfr1062 UTSW 2 86423412 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAACAGTTTCTGGAAGGTGAGTG -3'
(R):5'- CTGGCGGTCATCAACTTTGG -3'

Sequencing Primer
(F):5'- TCTGGAAGGTGAGTGTCAGAGC -3'
(R):5'- GTCATTGCTCCTAAAATGCTGG -3'
Posted On2016-08-04