Incidental Mutation 'R5351:Srrt'
ID423795
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
MMRRC Submission 042930-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5351 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 137298284 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 239 (*239W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000024099
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040873
AA Change: T467A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: T467A

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184197
Predicted Effect possibly damaging
Transcript: ENSMUST00000196109
AA Change: T109A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364
AA Change: T109A

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196208
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197409
Predicted Effect possibly damaging
Transcript: ENSMUST00000197466
AA Change: T467A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: T467A

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198526
AA Change: *468W
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364
AA Change: *468W

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199243
AA Change: T467A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: T467A

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably null
Transcript: ENSMUST00000199605
AA Change: *239W
Predicted Effect probably benign
Transcript: ENSMUST00000199756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200643
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,729,292 S34C probably damaging Het
Apol7e T G 15: 77,718,311 *370G probably null Het
Cacna2d4 T C 6: 119,268,201 I290T probably damaging Het
Ceacam12 T A 7: 18,067,234 V46D probably damaging Het
Ces1d A G 8: 93,178,078 Y345H probably damaging Het
Cirbp T C 10: 80,170,302 probably benign Het
Cnot8 T A 11: 58,115,321 H225Q probably damaging Het
Fstl1 T C 16: 37,829,180 V252A probably damaging Het
H2-T3 T C 17: 36,190,073 Q17R probably benign Het
Htt A G 5: 34,803,833 Y268C probably damaging Het
Ildr2 T C 1: 166,308,909 V439A possibly damaging Het
Lig1 T C 7: 13,300,949 M557T probably damaging Het
Ltbp2 T C 12: 84,790,358 E1229G possibly damaging Het
Mynn C T 3: 30,607,542 R258W probably benign Het
Nbas T A 12: 13,560,849 N2180K probably damaging Het
Olfr1062 A G 2: 86,423,266 S137P probably damaging Het
Pcdh1 C T 18: 38,197,766 G728D probably damaging Het
Pfas T C 11: 68,991,391 D882G probably damaging Het
Prkar2b C T 12: 31,972,127 G60R probably damaging Het
Prkdc G C 16: 15,831,312 V3717L probably benign Het
Prom1 A T 5: 44,044,355 V250E probably damaging Het
Slc35d1 A G 4: 103,189,839 L254P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A G 2: 76,943,041 V2339A probably damaging Het
Unc80 T A 1: 66,606,513 S1449R possibly damaging Het
Vmn2r24 A T 6: 123,816,264 K850M possibly damaging Het
Zfp516 A G 18: 82,956,751 E358G probably benign Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8027:Srrt UTSW 5 137302499 frame shift probably null
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGTTGGCCCTACAGAGAC -3'
(R):5'- GCTTTGTAAACGATACCCAGGC -3'

Sequencing Primer
(F):5'- TGGTCACAGTCCCAGAACTTC -3'
(R):5'- ATACCCAGGCTTTATGCGAG -3'
Posted On2016-08-04