Incidental Mutation 'R5351:Ceacam12'
ID423800
Institutional Source Beutler Lab
Gene Symbol Ceacam12
Ensembl Gene ENSMUSG00000030366
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 12
SynonymsCeacam12-C1, Ceacam12-C3, 1600031J20Rik
MMRRC Submission 042930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5351 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18065929-18077986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18067234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 46 (V46D)
Ref Sequence ENSEMBL: ENSMUSP00000032520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032520] [ENSMUST00000108483] [ENSMUST00000108487]
Predicted Effect probably damaging
Transcript: ENSMUST00000032520
AA Change: V46D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032520
Gene: ENSMUSG00000030366
AA Change: V46D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108483
AA Change: V46D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104123
Gene: ENSMUSG00000030366
AA Change: V46D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108487
AA Change: V46D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104127
Gene: ENSMUSG00000030366
AA Change: V46D

DomainStartEndE-ValueType
IG 40 141 7.77e-1 SMART
IG_like 159 260 4.78e1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,729,292 S34C probably damaging Het
Apol7e T G 15: 77,718,311 *370G probably null Het
Cacna2d4 T C 6: 119,268,201 I290T probably damaging Het
Ces1d A G 8: 93,178,078 Y345H probably damaging Het
Cirbp T C 10: 80,170,302 probably benign Het
Cnot8 T A 11: 58,115,321 H225Q probably damaging Het
Fstl1 T C 16: 37,829,180 V252A probably damaging Het
H2-T3 T C 17: 36,190,073 Q17R probably benign Het
Htt A G 5: 34,803,833 Y268C probably damaging Het
Ildr2 T C 1: 166,308,909 V439A possibly damaging Het
Lig1 T C 7: 13,300,949 M557T probably damaging Het
Ltbp2 T C 12: 84,790,358 E1229G possibly damaging Het
Mynn C T 3: 30,607,542 R258W probably benign Het
Nbas T A 12: 13,560,849 N2180K probably damaging Het
Olfr1062 A G 2: 86,423,266 S137P probably damaging Het
Pcdh1 C T 18: 38,197,766 G728D probably damaging Het
Pfas T C 11: 68,991,391 D882G probably damaging Het
Prkar2b C T 12: 31,972,127 G60R probably damaging Het
Prkdc G C 16: 15,831,312 V3717L probably benign Het
Prom1 A T 5: 44,044,355 V250E probably damaging Het
Slc35d1 A G 4: 103,189,839 L254P probably damaging Het
Srrt T C 5: 137,298,284 *239W probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A G 2: 76,943,041 V2339A probably damaging Het
Unc80 T A 1: 66,606,513 S1449R possibly damaging Het
Vmn2r24 A T 6: 123,816,264 K850M possibly damaging Het
Zfp516 A G 18: 82,956,751 E358G probably benign Het
Other mutations in Ceacam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Ceacam12 APN 7 18067261 missense probably damaging 1.00
IGL01483:Ceacam12 APN 7 18067521 missense probably benign 0.07
IGL01505:Ceacam12 APN 7 18067432 missense probably damaging 0.98
IGL01540:Ceacam12 APN 7 18071802 intron probably benign
R0033:Ceacam12 UTSW 7 18069460 splice site probably benign
R0033:Ceacam12 UTSW 7 18069460 splice site probably benign
R1816:Ceacam12 UTSW 7 18071765 synonymous probably null
R4227:Ceacam12 UTSW 7 18071753 missense probably benign 0.01
R4382:Ceacam12 UTSW 7 18066034 start gained probably benign
R4541:Ceacam12 UTSW 7 18071723 missense probably benign
R4651:Ceacam12 UTSW 7 18067434 missense probably damaging 1.00
R4652:Ceacam12 UTSW 7 18067434 missense probably damaging 1.00
R4831:Ceacam12 UTSW 7 18077380 splice site probably null
R5357:Ceacam12 UTSW 7 18077459 nonsense probably null
R5779:Ceacam12 UTSW 7 18069154 missense probably benign 0.29
R5893:Ceacam12 UTSW 7 18069374 missense probably damaging 1.00
R5946:Ceacam12 UTSW 7 18069206 missense probably damaging 1.00
R6151:Ceacam12 UTSW 7 18069105 missense probably benign 0.01
R6175:Ceacam12 UTSW 7 18067387 missense probably damaging 1.00
R6346:Ceacam12 UTSW 7 18069401 missense probably damaging 0.99
R6491:Ceacam12 UTSW 7 18069260 missense probably damaging 1.00
R6591:Ceacam12 UTSW 7 18069224 missense possibly damaging 0.53
R6691:Ceacam12 UTSW 7 18069224 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATCAGAGGTAATTTTGCTCACCC -3'
(R):5'- GAGCATCGTCTCTCTACCAC -3'

Sequencing Primer
(F):5'- ACCCCTTTAAAGTACATTGGTGC -3'
(R):5'- ACTGTGTGCAGGTCCCATCAC -3'
Posted On2016-08-04