Incidental Mutation 'R5351:Cnot8'
ID423806
Institutional Source Beutler Lab
Gene Symbol Cnot8
Ensembl Gene ENSMUSG00000020515
Gene NameCCR4-NOT transcription complex, subunit 8
Synonyms
MMRRC Submission 042930-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R5351 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58104153-58118594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58115321 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 225 (H225Q)
Ref Sequence ENSEMBL: ENSMUSP00000104471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020822] [ENSMUST00000108843] [ENSMUST00000134896] [ENSMUST00000172035]
Predicted Effect probably damaging
Transcript: ENSMUST00000020822
AA Change: H225Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020822
Gene: ENSMUSG00000020515
AA Change: H225Q

DomainStartEndE-ValueType
Pfam:CAF1 15 139 4.3e-15 PFAM
Pfam:CAF1 138 238 1.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108843
AA Change: H225Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104471
Gene: ENSMUSG00000020515
AA Change: H225Q

DomainStartEndE-ValueType
Pfam:CAF1 13 240 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133923
Predicted Effect probably benign
Transcript: ENSMUST00000134896
SMART Domains Protein: ENSMUSP00000116116
Gene: ENSMUSG00000020515

DomainStartEndE-ValueType
Pfam:CAF1 13 75 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172035
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,729,292 S34C probably damaging Het
Apol7e T G 15: 77,718,311 *370G probably null Het
Cacna2d4 T C 6: 119,268,201 I290T probably damaging Het
Ceacam12 T A 7: 18,067,234 V46D probably damaging Het
Ces1d A G 8: 93,178,078 Y345H probably damaging Het
Cirbp T C 10: 80,170,302 probably benign Het
Fstl1 T C 16: 37,829,180 V252A probably damaging Het
H2-T3 T C 17: 36,190,073 Q17R probably benign Het
Htt A G 5: 34,803,833 Y268C probably damaging Het
Ildr2 T C 1: 166,308,909 V439A possibly damaging Het
Lig1 T C 7: 13,300,949 M557T probably damaging Het
Ltbp2 T C 12: 84,790,358 E1229G possibly damaging Het
Mynn C T 3: 30,607,542 R258W probably benign Het
Nbas T A 12: 13,560,849 N2180K probably damaging Het
Olfr1062 A G 2: 86,423,266 S137P probably damaging Het
Pcdh1 C T 18: 38,197,766 G728D probably damaging Het
Pfas T C 11: 68,991,391 D882G probably damaging Het
Prkar2b C T 12: 31,972,127 G60R probably damaging Het
Prkdc G C 16: 15,831,312 V3717L probably benign Het
Prom1 A T 5: 44,044,355 V250E probably damaging Het
Slc35d1 A G 4: 103,189,839 L254P probably damaging Het
Srrt T C 5: 137,298,284 *239W probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A G 2: 76,943,041 V2339A probably damaging Het
Unc80 T A 1: 66,606,513 S1449R possibly damaging Het
Vmn2r24 A T 6: 123,816,264 K850M possibly damaging Het
Zfp516 A G 18: 82,956,751 E358G probably benign Het
Other mutations in Cnot8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Cnot8 APN 11 58111362 missense probably damaging 1.00
IGL01774:Cnot8 APN 11 58115307 missense probably benign 0.01
IGL02877:Cnot8 APN 11 58111402 missense probably benign 0.01
straws UTSW 11 58114065 missense probably damaging 1.00
R0465:Cnot8 UTSW 11 58114060 missense probably damaging 0.99
R1802:Cnot8 UTSW 11 58117535 missense probably benign 0.01
R2418:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R2419:Cnot8 UTSW 11 58115310 missense probably damaging 1.00
R5199:Cnot8 UTSW 11 58115274 nonsense probably null
R5257:Cnot8 UTSW 11 58117522 missense possibly damaging 0.94
R5317:Cnot8 UTSW 11 58113203 missense probably damaging 1.00
R5702:Cnot8 UTSW 11 58114047 missense possibly damaging 0.71
R6106:Cnot8 UTSW 11 58113990 missense probably damaging 0.96
R6261:Cnot8 UTSW 11 58114051 missense probably damaging 1.00
R6419:Cnot8 UTSW 11 58114065 missense probably damaging 1.00
R6947:Cnot8 UTSW 11 58117505 missense probably benign 0.03
R7070:Cnot8 UTSW 11 58117452 missense probably benign 0.00
R7888:Cnot8 UTSW 11 58111311 missense probably benign
Z1176:Cnot8 UTSW 11 58113090 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGGGTACTGTTTGGGAAGAAT -3'
(R):5'- CAGCCTCTGTAGATAGACTAACAA -3'

Sequencing Primer
(F):5'- TGAAGGTCTGAAAAATGGCTACTG -3'
(R):5'- AATAACATTCCTACTGTAGAAAGCAG -3'
Posted On2016-08-04