Incidental Mutation 'R5351:H2-T3'
ID 423817
Institutional Source Beutler Lab
Gene Symbol H2-T3
Ensembl Gene ENSMUSG00000054128
Gene Name histocompatibility 2, T region locus 3
Synonyms TL, H-2T3, H2-Tw3
MMRRC Submission 042930-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5351 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 36496463-36501043 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36500965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 17 (Q17R)
Ref Sequence ENSEMBL: ENSMUSP00000134547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025312] [ENSMUST00000095300] [ENSMUST00000097329] [ENSMUST00000102675] [ENSMUST00000172663] [ENSMUST00000174101] [ENSMUST00000173133] [ENSMUST00000173629]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025312
AA Change: Q19R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000025312
Gene: ENSMUSG00000054128
AA Change: Q19R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 120 2.5e-40 PFAM
Pfam:MHC_I 114 161 3.7e-14 PFAM
IGc1 180 251 1.6e-20 SMART
transmembrane domain 271 290 N/A INTRINSIC
low complexity region 293 301 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095300
AA Change: Q17R
Predicted Effect unknown
Transcript: ENSMUST00000097329
AA Change: Q17R
SMART Domains Protein: ENSMUSP00000138177
Gene: ENSMUSG00000054128
AA Change: Q17R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102675
AA Change: Q19R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099736
Gene: ENSMUSG00000054128
AA Change: Q19R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 9.3e-85 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172663
AA Change: Q17R

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134547
Gene: ENSMUSG00000054128
AA Change: Q17R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172822
Predicted Effect probably benign
Transcript: ENSMUST00000174101
AA Change: Q17R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000173133
AA Change: Q19R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134469
Gene: ENSMUSG00000054128
AA Change: Q19R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 2.6e-84 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173577
Predicted Effect probably benign
Transcript: ENSMUST00000173629
AA Change: Q17R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134607
Gene: ENSMUSG00000054128
AA Change: Q17R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 119 1.4e-40 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus contains the sole gene encoding the thymic leukemia antigen or TL antigen in "b haplotype" mice such as C57BL/6. Mice homozygous for a targeted knock-out are viable with normal reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,522,941 (GRCm39) S34C probably damaging Het
Apol7e T G 15: 77,602,511 (GRCm39) *370G probably null Het
Cacna2d4 T C 6: 119,245,162 (GRCm39) I290T probably damaging Het
Ceacam12 T A 7: 17,801,159 (GRCm39) V46D probably damaging Het
Ces1d A G 8: 93,904,706 (GRCm39) Y345H probably damaging Het
Cirbp T C 10: 80,006,136 (GRCm39) probably benign Het
Cnot8 T A 11: 58,006,147 (GRCm39) H225Q probably damaging Het
Fstl1 T C 16: 37,649,542 (GRCm39) V252A probably damaging Het
Htt A G 5: 34,961,177 (GRCm39) Y268C probably damaging Het
Ildr2 T C 1: 166,136,478 (GRCm39) V439A possibly damaging Het
Lig1 T C 7: 13,034,875 (GRCm39) M557T probably damaging Het
Ltbp2 T C 12: 84,837,132 (GRCm39) E1229G possibly damaging Het
Mynn C T 3: 30,661,691 (GRCm39) R258W probably benign Het
Nbas T A 12: 13,610,850 (GRCm39) N2180K probably damaging Het
Or8j3c A G 2: 86,253,610 (GRCm39) S137P probably damaging Het
Pcdh1 C T 18: 38,330,819 (GRCm39) G728D probably damaging Het
Pfas T C 11: 68,882,217 (GRCm39) D882G probably damaging Het
Prkar2b C T 12: 32,022,126 (GRCm39) G60R probably damaging Het
Prkdc G C 16: 15,649,176 (GRCm39) V3717L probably benign Het
Prom1 A T 5: 44,201,697 (GRCm39) V250E probably damaging Het
Slc35d1 A G 4: 103,047,036 (GRCm39) L254P probably damaging Het
Srrt T C 5: 137,296,546 (GRCm39) *239W probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Ttn A G 2: 76,773,385 (GRCm39) V2339A probably damaging Het
Unc80 T A 1: 66,645,672 (GRCm39) S1449R possibly damaging Het
Vmn2r24 A T 6: 123,793,223 (GRCm39) K850M possibly damaging Het
Zfp516 A G 18: 82,974,876 (GRCm39) E358G probably benign Het
Other mutations in H2-T3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:H2-T3 APN 17 36,497,933 (GRCm39) missense probably benign
IGL01922:H2-T3 APN 17 36,497,992 (GRCm39) missense possibly damaging 0.53
IGL02389:H2-T3 APN 17 36,497,500 (GRCm39) missense probably benign 0.01
IGL02423:H2-T3 APN 17 36,498,248 (GRCm39) missense probably damaging 0.98
IGL02963:H2-T3 APN 17 36,500,526 (GRCm39) missense probably damaging 0.98
IGL03298:H2-T3 APN 17 36,500,320 (GRCm39) missense probably damaging 1.00
hyperbole UTSW 17 36,498,237 (GRCm39) missense probably damaging 1.00
simile UTSW 17 36,497,962 (GRCm39) missense probably damaging 0.99
R1479:H2-T3 UTSW 17 36,500,320 (GRCm39) missense probably damaging 1.00
R2907:H2-T3 UTSW 17 36,498,347 (GRCm39) missense possibly damaging 0.90
R3623:H2-T3 UTSW 17 36,500,957 (GRCm39) missense possibly damaging 0.91
R3624:H2-T3 UTSW 17 36,500,957 (GRCm39) missense possibly damaging 0.91
R3779:H2-T3 UTSW 17 36,500,574 (GRCm39) missense probably damaging 0.99
R4271:H2-T3 UTSW 17 36,500,510 (GRCm39) missense probably damaging 1.00
R4586:H2-T3 UTSW 17 36,500,236 (GRCm39) splice site probably null
R5387:H2-T3 UTSW 17 36,497,594 (GRCm39) missense probably benign 0.00
R5474:H2-T3 UTSW 17 36,500,999 (GRCm39) missense probably damaging 0.99
R5711:H2-T3 UTSW 17 36,498,301 (GRCm39) missense probably damaging 1.00
R6458:H2-T3 UTSW 17 36,497,911 (GRCm39) missense possibly damaging 0.53
R6849:H2-T3 UTSW 17 36,500,697 (GRCm39) missense probably benign 0.32
R6956:H2-T3 UTSW 17 36,500,263 (GRCm39) missense probably damaging 1.00
R6993:H2-T3 UTSW 17 36,497,962 (GRCm39) missense probably damaging 0.99
R7336:H2-T3 UTSW 17 36,498,237 (GRCm39) missense probably damaging 1.00
R7414:H2-T3 UTSW 17 36,498,275 (GRCm39) missense not run
R8143:H2-T3 UTSW 17 36,498,384 (GRCm39) missense probably benign 0.35
R8901:H2-T3 UTSW 17 36,498,252 (GRCm39) missense probably damaging 0.99
R9697:H2-T3 UTSW 17 36,500,744 (GRCm39) missense probably damaging 0.98
RF009:H2-T3 UTSW 17 36,500,294 (GRCm39) intron probably benign
Z1176:H2-T3 UTSW 17 36,497,474 (GRCm39) missense possibly damaging 0.86
Z1176:H2-T3 UTSW 17 36,497,472 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGTGTAGAAGTACCTCAGCG -3'
(R):5'- TTTCAAAGGCCTTGCACTCCTG -3'

Sequencing Primer
(F):5'- GTGAGACTGTGACCTTCTCCCAG -3'
(R):5'- ACTCCTGTTGAGAGCAGGTAC -3'
Posted On 2016-08-04