Incidental Mutation 'R5352:Rp1'
ID 423820
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 3999557-4409241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4347098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1264 (S1264G)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: S1264G

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
R8500:Rp1 UTSW 1 4346590 missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4349561 missense probably damaging 1.00
R8672:Rp1 UTSW 1 4348784 missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4346405 missense probably benign 0.01
R8792:Rp1 UTSW 1 4024868 missense unknown
R8859:Rp1 UTSW 1 4349960 missense probably benign 0.07
R8945:Rp1 UTSW 1 4349594 missense probably benign 0.42
R8959:Rp1 UTSW 1 4349427 intron probably benign
R8979:Rp1 UTSW 1 4148714 missense unknown
R9126:Rp1 UTSW 1 4346913 missense probably damaging 0.99
R9156:Rp1 UTSW 1 4163938 missense unknown
R9160:Rp1 UTSW 1 4346497 missense probably benign 0.00
R9221:Rp1 UTSW 1 4245043 missense unknown
R9263:Rp1 UTSW 1 4348452 missense probably benign 0.25
R9263:Rp1 UTSW 1 4348937 missense probably benign 0.02
R9302:Rp1 UTSW 1 4346566 missense probably damaging 1.00
R9318:Rp1 UTSW 1 4348265 missense probably benign 0.09
R9414:Rp1 UTSW 1 4243618 missense unknown
R9474:Rp1 UTSW 1 4092615 critical splice donor site probably null
R9478:Rp1 UTSW 1 4347322 missense probably benign 0.06
R9529:Rp1 UTSW 1 4346224 missense probably benign
R9572:Rp1 UTSW 1 4348439 missense probably benign
R9673:Rp1 UTSW 1 4267569 missense unknown
R9709:Rp1 UTSW 1 4042032 missense unknown
R9716:Rp1 UTSW 1 4142610 critical splice donor site probably null
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTCCAGATCATCAGTGCATTTG -3'
(R):5'- ATCCAGCCTTCATAGTGTGGAC -3'

Sequencing Primer
(F):5'- CAGATCATCAGTGCATTTGTTTTC -3'
(R):5'- AGCCTTCATAGTGTGGACGAGTG -3'
Posted On 2016-08-04