Incidental Mutation 'R5352:Sag'
ID423821
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene NameS-antigen, retina and pineal gland (arrestin)
Synonymsarrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87803680-87845158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87812993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 46 (V46L)
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
Predicted Effect probably benign
Transcript: ENSMUST00000077772
AA Change: V46L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: V46L

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156381
Predicted Effect probably benign
Transcript: ENSMUST00000177757
AA Change: V46L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: V46L

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Meta Mutation Damage Score 0.3115 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87824424 critical splice acceptor site probably null
IGL00822:Sag APN 1 87845026 unclassified probably null
IGL01140:Sag APN 1 87823364 missense probably benign 0.22
IGL01612:Sag APN 1 87805349 missense probably damaging 0.98
IGL02183:Sag APN 1 87828475 splice site probably null
IGL02893:Sag APN 1 87834593 missense probably benign 0.01
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0091:Sag UTSW 1 87814680 missense probably damaging 0.96
R0531:Sag UTSW 1 87834629 critical splice donor site probably null
R0609:Sag UTSW 1 87812991 missense probably damaging 0.98
R1328:Sag UTSW 1 87810294 splice site probably benign
R1395:Sag UTSW 1 87828441 missense probably benign 0.01
R1748:Sag UTSW 1 87831940 missense probably damaging 1.00
R1858:Sag UTSW 1 87814848 missense probably benign
R2020:Sag UTSW 1 87805315 missense probably damaging 1.00
R3854:Sag UTSW 1 87824518 splice site probably benign
R4021:Sag UTSW 1 87821305 critical splice acceptor site probably null
R4298:Sag UTSW 1 87845015 missense probably benign
R4630:Sag UTSW 1 87834618 missense probably damaging 0.99
R5680:Sag UTSW 1 87821337 missense possibly damaging 0.83
R6164:Sag UTSW 1 87824453 missense probably damaging 1.00
R6407:Sag UTSW 1 87814806 missense probably benign
R7431:Sag UTSW 1 87821337 missense possibly damaging 0.83
R7548:Sag UTSW 1 87844916 missense probably benign 0.01
R8122:Sag UTSW 1 87834567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGATGGTGAATCAGGC -3'
(R):5'- GCACTGTGATACTGTGGCAC -3'

Sequencing Primer
(F):5'- CCTGGAGGCAGGAGGATTACTTG -3'
(R):5'- TGTGGCACAGAACTTTGCAAG -3'
Posted On2016-08-04