Incidental Mutation 'R5352:Tnni1'
ID423824
Institutional Source Beutler Lab
Gene Symbol Tnni1
Ensembl Gene ENSMUSG00000026418
Gene Nametroponin I, skeletal, slow 1
SynonymsssTnI, 2700018B22Rik
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135779434-135810989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135805592 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 51 (T51A)
Ref Sequence ENSEMBL: ENSMUSP00000121122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132795] [ENSMUST00000139986] [ENSMUST00000148201] [ENSMUST00000152075] [ENSMUST00000152208] [ENSMUST00000154463]
Predicted Effect unknown
Transcript: ENSMUST00000129217
AA Change: T44A
SMART Domains Protein: ENSMUSP00000119848
Gene: ENSMUSG00000026418
AA Change: T44A

DomainStartEndE-ValueType
Pfam:Troponin 9 140 2.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132795
AA Change: T51A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121122
Gene: ENSMUSG00000026418
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Troponin 15 60 7.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137331
Predicted Effect probably benign
Transcript: ENSMUST00000139986
AA Change: T35A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123049
Gene: ENSMUSG00000026418
AA Change: T35A

DomainStartEndE-ValueType
Pfam:Troponin 1 130 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148201
AA Change: T51A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123509
Gene: ENSMUSG00000026418
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152075
AA Change: T51A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121343
Gene: ENSMUSG00000026418
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152208
AA Change: T51A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121966
Gene: ENSMUSG00000026418
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 8.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154463
AA Change: T51A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122925
Gene: ENSMUSG00000026418
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Troponin 15 146 1.4e-49 PFAM
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Tnni1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Tnni1 APN 1 135805496 splice site probably null
R1758:Tnni1 UTSW 1 135808682 missense probably damaging 1.00
R2035:Tnni1 UTSW 1 135805592 missense probably benign 0.00
R3548:Tnni1 UTSW 1 135805053 critical splice acceptor site probably null
R6477:Tnni1 UTSW 1 135805566 missense probably benign 0.00
R7434:Tnni1 UTSW 1 135807522 missense
X0018:Tnni1 UTSW 1 135808720 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAACAAGCTTTGGTGGCAGC -3'
(R):5'- TCACTTCCTGTGCAGTTGTG -3'

Sequencing Primer
(F):5'- TGCCACACTGAGCAATGG -3'
(R):5'- CCTGTGCAGTTGTGAGACTGG -3'
Posted On2016-08-04