Incidental Mutation 'R5352:Ola1'
ID423826
Institutional Source Beutler Lab
Gene Symbol Ola1
Ensembl Gene ENSMUSG00000027108
Gene NameObg-like ATPase 1
Synonyms2510025G09Rik, 2810409H07Rik, 2810405J23Rik, Gtpbp9
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73092801-73218924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73099330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000028517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028517] [ENSMUST00000112055]
Predicted Effect probably damaging
Transcript: ENSMUST00000028517
AA Change: T310A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028517
Gene: ENSMUSG00000027108
AA Change: T310A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:FeoB_N 23 74 2.2e-8 PFAM
Pfam:MMR_HSR1 24 164 1.2e-22 PFAM
Pfam:YchF-GTPase_C 305 388 9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112055
SMART Domains Protein: ENSMUSP00000107686
Gene: ENSMUSG00000027108

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:FeoB_N 23 74 1.5e-7 PFAM
Pfam:MMR_HSR1 24 259 3.2e-18 PFAM
low complexity region 261 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152608
Meta Mutation Damage Score 0.9175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase protein family. The encoded protein interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. Overexpression of this gene has been observed in multiple types of cancer and may be associated with poor survival. Pseudogenes of this gene have been defined on chromosomes 17 and 22. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele display partial neonatal lethality, embryonic developmental delay, delayed development of lung and liver, and reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Ola1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ola1 APN 2 73156897 missense probably benign 0.00
IGL01969:Ola1 APN 2 73100146 missense probably benign 0.01
IGL02605:Ola1 APN 2 73142300 splice site probably benign
IGL02987:Ola1 APN 2 73156898 missense probably benign 0.03
IGL03171:Ola1 APN 2 73156853 missense probably benign 0.24
R0602:Ola1 UTSW 2 73093712 missense probably damaging 1.00
R1167:Ola1 UTSW 2 73097194 missense probably damaging 0.99
R1474:Ola1 UTSW 2 73156844 missense probably damaging 1.00
R1650:Ola1 UTSW 2 73156894 missense possibly damaging 0.65
R1781:Ola1 UTSW 2 73156755 missense possibly damaging 0.92
R3732:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3732:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3733:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3918:Ola1 UTSW 2 73142339 missense probably benign 0.33
R4650:Ola1 UTSW 2 73141965 missense probably damaging 1.00
R5304:Ola1 UTSW 2 73199434 missense probably damaging 0.99
R5918:Ola1 UTSW 2 73156784 missense probably benign 0.18
R6062:Ola1 UTSW 2 73199498 missense probably damaging 1.00
R6858:Ola1 UTSW 2 73097230 missense probably damaging 0.97
R7077:Ola1 UTSW 2 73141964 missense probably damaging 1.00
R8223:Ola1 UTSW 2 73099350 missense probably damaging 1.00
R8343:Ola1 UTSW 2 73199401 missense probably damaging 0.99
R9031:Ola1 UTSW 2 73093716 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACCTGCCTCAATCAATGCCG -3'
(R):5'- CCAGTGTGCTGTGAAAGATGAATG -3'

Sequencing Primer
(F):5'- AATCAATGCCGCTCCACTTTCAC -3'
(R):5'- GCTGTGAAAGATGAATGGTCATTTAC -3'
Posted On2016-08-04