Incidental Mutation 'R5352:Grm5'
ID 423839
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Name glutamate receptor, metabotropic 5
Synonyms mGluR5, 6430542K11Rik, Gprc1e, Glu5R
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 87233376-87784115 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87724058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 783 (I783V)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
AlphaFold Q3UVX5
Predicted Effect possibly damaging
Transcript: ENSMUST00000107263
AA Change: I783V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125009
AA Change: I783V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155358
AA Change: I783V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167164
AA Change: I783V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: I783V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Meta Mutation Damage Score 0.1161 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 87,779,989 (GRCm39) missense probably benign 0.00
IGL00970:Grm5 APN 7 87,453,104 (GRCm39) missense probably damaging 0.97
IGL01286:Grm5 APN 7 87,251,773 (GRCm39) missense probably benign 0.00
IGL01307:Grm5 APN 7 87,724,220 (GRCm39) missense probably damaging 1.00
IGL01603:Grm5 APN 7 87,252,386 (GRCm39) missense probably damaging 1.00
IGL01646:Grm5 APN 7 87,689,267 (GRCm39) missense probably damaging 1.00
IGL01705:Grm5 APN 7 87,779,254 (GRCm39) missense possibly damaging 0.59
IGL02184:Grm5 APN 7 87,675,650 (GRCm39) missense probably damaging 0.98
IGL02504:Grm5 APN 7 87,779,980 (GRCm39) missense probably benign
IGL02689:Grm5 APN 7 87,251,918 (GRCm39) missense probably damaging 1.00
IGL02725:Grm5 APN 7 87,723,873 (GRCm39) missense probably damaging 1.00
IGL02851:Grm5 APN 7 87,723,918 (GRCm39) missense probably damaging 0.98
IGL03106:Grm5 APN 7 87,685,278 (GRCm39) missense probably damaging 1.00
IGL03257:Grm5 APN 7 87,252,106 (GRCm39) missense possibly damaging 0.69
IGL03291:Grm5 APN 7 87,780,004 (GRCm39) missense probably damaging 1.00
BB004:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
BB014:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
R0078:Grm5 UTSW 7 87,724,185 (GRCm39) missense probably damaging 1.00
R0314:Grm5 UTSW 7 87,252,163 (GRCm39) missense probably damaging 0.97
R0318:Grm5 UTSW 7 87,252,175 (GRCm39) missense probably damaging 0.99
R0364:Grm5 UTSW 7 87,723,594 (GRCm39) missense probably damaging 1.00
R0380:Grm5 UTSW 7 87,723,584 (GRCm39) missense possibly damaging 0.92
R0454:Grm5 UTSW 7 87,779,997 (GRCm39) missense probably damaging 1.00
R0494:Grm5 UTSW 7 87,779,989 (GRCm39) missense probably benign 0.00
R0562:Grm5 UTSW 7 87,252,227 (GRCm39) missense probably damaging 1.00
R1695:Grm5 UTSW 7 87,685,311 (GRCm39) missense possibly damaging 0.47
R2012:Grm5 UTSW 7 87,724,080 (GRCm39) missense probably damaging 1.00
R2384:Grm5 UTSW 7 87,251,936 (GRCm39) missense probably damaging 1.00
R2510:Grm5 UTSW 7 87,685,299 (GRCm39) missense probably benign 0.21
R2870:Grm5 UTSW 7 87,251,930 (GRCm39) missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87,251,930 (GRCm39) missense possibly damaging 0.85
R3861:Grm5 UTSW 7 87,779,202 (GRCm39) missense possibly damaging 0.94
R4451:Grm5 UTSW 7 87,724,340 (GRCm39) critical splice donor site probably null
R4626:Grm5 UTSW 7 87,779,361 (GRCm39) missense probably damaging 1.00
R4728:Grm5 UTSW 7 87,624,496 (GRCm39) missense probably damaging 1.00
R4914:Grm5 UTSW 7 87,779,337 (GRCm39) missense probably benign 0.00
R5122:Grm5 UTSW 7 87,724,028 (GRCm39) missense probably damaging 1.00
R5361:Grm5 UTSW 7 87,723,704 (GRCm39) missense probably damaging 1.00
R5684:Grm5 UTSW 7 87,779,853 (GRCm39) missense probably benign
R5715:Grm5 UTSW 7 87,779,464 (GRCm39) missense probably benign 0.05
R5759:Grm5 UTSW 7 87,675,808 (GRCm39) missense probably damaging 0.96
R5844:Grm5 UTSW 7 87,453,232 (GRCm39) missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87,252,281 (GRCm39) missense probably damaging 1.00
R6048:Grm5 UTSW 7 87,675,758 (GRCm39) missense probably damaging 1.00
R6145:Grm5 UTSW 7 87,675,809 (GRCm39) missense probably damaging 1.00
R6232:Grm5 UTSW 7 87,251,638 (GRCm39) unclassified probably benign
R6972:Grm5 UTSW 7 87,252,131 (GRCm39) missense probably benign 0.02
R7072:Grm5 UTSW 7 87,723,512 (GRCm39) missense probably damaging 1.00
R7258:Grm5 UTSW 7 87,723,914 (GRCm39) missense probably damaging 0.96
R7316:Grm5 UTSW 7 87,624,473 (GRCm39) missense probably benign
R7434:Grm5 UTSW 7 87,779,682 (GRCm39) missense probably benign 0.10
R7521:Grm5 UTSW 7 87,723,480 (GRCm39) missense possibly damaging 0.86
R7616:Grm5 UTSW 7 87,765,409 (GRCm39) missense probably benign
R7631:Grm5 UTSW 7 87,624,513 (GRCm39) missense probably damaging 1.00
R7655:Grm5 UTSW 7 87,779,459 (GRCm39) missense probably benign 0.00
R7656:Grm5 UTSW 7 87,779,459 (GRCm39) missense probably benign 0.00
R7739:Grm5 UTSW 7 87,779,266 (GRCm39) missense possibly damaging 0.46
R7897:Grm5 UTSW 7 87,780,069 (GRCm39) missense probably benign 0.14
R7927:Grm5 UTSW 7 87,685,382 (GRCm39) missense probably benign 0.16
R7967:Grm5 UTSW 7 87,624,569 (GRCm39) missense probably damaging 0.99
R8260:Grm5 UTSW 7 87,724,340 (GRCm39) critical splice donor site probably null
R8345:Grm5 UTSW 7 87,723,746 (GRCm39) missense probably damaging 1.00
R8460:Grm5 UTSW 7 87,252,249 (GRCm39) missense probably damaging 1.00
R8473:Grm5 UTSW 7 87,252,278 (GRCm39) missense probably damaging 0.97
R8531:Grm5 UTSW 7 87,779,724 (GRCm39) missense probably benign 0.05
R8671:Grm5 UTSW 7 87,765,498 (GRCm39) critical splice donor site probably null
R8805:Grm5 UTSW 7 87,453,176 (GRCm39) missense probably damaging 1.00
R9036:Grm5 UTSW 7 87,685,397 (GRCm39) missense possibly damaging 0.94
R9106:Grm5 UTSW 7 87,723,747 (GRCm39) missense probably damaging 1.00
R9136:Grm5 UTSW 7 87,689,254 (GRCm39) missense possibly damaging 0.95
R9189:Grm5 UTSW 7 87,724,024 (GRCm39) missense probably damaging 1.00
R9196:Grm5 UTSW 7 87,723,518 (GRCm39) missense probably damaging 1.00
R9232:Grm5 UTSW 7 87,723,591 (GRCm39) missense probably damaging 1.00
R9234:Grm5 UTSW 7 87,723,440 (GRCm39) missense probably damaging 1.00
R9384:Grm5 UTSW 7 87,723,518 (GRCm39) missense probably damaging 1.00
R9424:Grm5 UTSW 7 87,765,484 (GRCm39) missense probably benign 0.00
R9531:Grm5 UTSW 7 87,780,075 (GRCm39) makesense probably null
R9631:Grm5 UTSW 7 87,624,560 (GRCm39) missense probably damaging 0.98
R9691:Grm5 UTSW 7 87,723,903 (GRCm39) missense probably damaging 1.00
Z1176:Grm5 UTSW 7 87,251,923 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATCCAAGCATCCGAGAAG -3'
(R):5'- GGATGATGACTTGCCATCTCC -3'

Sequencing Primer
(F):5'- AGCATCCGAGAAGTCTACTTG -3'
(R):5'- ATGCGCACCACTGTAGAG -3'
Posted On 2016-08-04