Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Rasa3'

423842

Institutional Source

Beutler Lab

Gene Symbol

Rasa3

Ensembl Gene

ENSMUSG00000031453

Gene Name

RAS p21 protein activator 3

Synonyms

GAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13566948-13677603 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 13631778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 57 (L57R)

Ref Sequence

ENSEMBL: ENSMUSP00000112998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]

AlphaFold

Q60790

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117551
AA Change: L57R

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: L57R

Domain	Start	End	E-Value	Type
C2	13	111	2.29e-15	SMART
C2	146	262	1.03e-17	SMART
RasGAP	275	614	3.96e-166	SMART
PH	577	679	5.53e-16	SMART
BTK	679	715	9.16e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132439

Predicted Effect

probably benign
Transcript: ENSMUST00000154454

Meta Mutation Damage Score

0.5789

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Rasa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Rasa3	APN	8	13595410	unclassified	probably benign
IGL02112:Rasa3	APN	8	13585042	splice site	probably benign
IGL02946:Rasa3	APN	8	13598280	missense	probably benign	0.33
IGL03085:Rasa3	APN	8	13585690	missense	probably benign	0.11
Box_canyon	UTSW	8	13584959	nonsense	probably null
Erasor	UTSW	8	13586873	critical splice donor site	probably null
koko_head	UTSW	8	13614605	missense	possibly damaging	0.70
Mount_ouray	UTSW	8	13631811	missense	possibly damaging	0.90
Poncha_pass	UTSW	8	13595373	missense	possibly damaging	0.46
Tabula	UTSW	8	13585029	missense	probably damaging	1.00
Ute	UTSW	8	13582381	splice site	probably benign
PIT4531001:Rasa3	UTSW	8	13605887	missense	probably benign	0.11
R0193:Rasa3	UTSW	8	13570233	splice site	probably null
R0710:Rasa3	UTSW	8	13583830	missense	probably damaging	1.00
R0726:Rasa3	UTSW	8	13580118	splice site	probably benign
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1797:Rasa3	UTSW	8	13582372	missense	probably benign	0.44
R1828:Rasa3	UTSW	8	13585035	missense	probably benign	0.02
R1895:Rasa3	UTSW	8	13631768	splice site	probably benign
R2090:Rasa3	UTSW	8	13582381	splice site	probably benign
R2374:Rasa3	UTSW	8	13577411	missense	probably damaging	1.00
R2655:Rasa3	UTSW	8	13595373	missense	possibly damaging	0.46
R3703:Rasa3	UTSW	8	13588972	missense	probably benign
R3899:Rasa3	UTSW	8	13578635	missense	probably benign	0.21
R4230:Rasa3	UTSW	8	13570264	missense	possibly damaging	0.47
R4256:Rasa3	UTSW	8	13614532	critical splice donor site	probably null
R4281:Rasa3	UTSW	8	13588946	missense	probably benign	0.01
R4498:Rasa3	UTSW	8	13614587	missense	probably benign	0.01
R4558:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4559:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4647:Rasa3	UTSW	8	13588865	missense	probably null	0.00
R4702:Rasa3	UTSW	8	13570394	missense	probably benign	0.09
R4772:Rasa3	UTSW	8	13598289	missense	probably damaging	1.00
R4774:Rasa3	UTSW	8	13577501	missense	probably benign	0.07
R4807:Rasa3	UTSW	8	13614633	missense	probably damaging	1.00
R5008:Rasa3	UTSW	8	13584959	nonsense	probably null
R5043:Rasa3	UTSW	8	13570368	missense	possibly damaging	0.59
R5435:Rasa3	UTSW	8	13631811	missense	possibly damaging	0.90
R6207:Rasa3	UTSW	8	13598251	missense	possibly damaging	0.67
R6733:Rasa3	UTSW	8	13580037	missense	possibly damaging	0.88
R6855:Rasa3	UTSW	8	13585029	missense	probably damaging	1.00
R7024:Rasa3	UTSW	8	13631826	missense	probably benign	0.29
R7100:Rasa3	UTSW	8	13586897	missense	probably benign	0.02
R7322:Rasa3	UTSW	8	13595857	missense	possibly damaging	0.46
R7394:Rasa3	UTSW	8	13595353	missense	probably benign	0.03
R7478:Rasa3	UTSW	8	13614605	missense	possibly damaging	0.70
R7486:Rasa3	UTSW	8	13590201	critical splice donor site	probably null
R7554:Rasa3	UTSW	8	13595390	missense	probably damaging	0.99
R7575:Rasa3	UTSW	8	13595887	missense	possibly damaging	0.73
R7641:Rasa3	UTSW	8	13584961	missense	probably benign	0.11
R7667:Rasa3	UTSW	8	13588015	missense	probably benign	0.27
R7751:Rasa3	UTSW	8	13568708	missense	probably benign	0.18
R7999:Rasa3	UTSW	8	13631805	missense	probably benign	0.04
R8039:Rasa3	UTSW	8	13588931	missense	probably damaging	1.00
R8125:Rasa3	UTSW	8	13577801	splice site	probably null
R8514:Rasa3	UTSW	8	13581322	missense	probably benign	0.02
R8726:Rasa3	UTSW	8	13576381	missense	probably benign	0.00
R8728:Rasa3	UTSW	8	13586873	critical splice donor site	probably null
R8790:Rasa3	UTSW	8	13677391	critical splice donor site	probably null
R9036:Rasa3	UTSW	8	13595851	missense	probably benign	0.06
R9483:Rasa3	UTSW	8	13580033	critical splice donor site	probably null
R9602:Rasa3	UTSW	8	13631844	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTCATACTTCAGTGCCCTGG -3'
(R):5'- CAGGTCTGCTTGTGAAGTGAC -3'

Sequencing Primer
(F):5'- CCCTGGAGAGCAGGAACATC -3'
(R):5'- GGTAGCTTGACGATATATGTGACTAC -3'

Posted On

2016-08-04