Incidental Mutation 'R5352:Rasa3'
ID423842
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene NameRAS p21 protein activator 3
SynonymsGAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13566948-13677603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13631778 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 57 (L57R)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117551
AA Change: L57R

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: L57R

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132439
Predicted Effect probably benign
Transcript: ENSMUST00000154454
Meta Mutation Damage Score 0.5789 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13595410 unclassified probably benign
IGL02112:Rasa3 APN 8 13585042 splice site probably benign
IGL02946:Rasa3 APN 8 13598280 missense probably benign 0.33
IGL03085:Rasa3 APN 8 13585690 missense probably benign 0.11
Box_canyon UTSW 8 13584959 nonsense probably null
koko_head UTSW 8 13614605 missense possibly damaging 0.70
Mount_ouray UTSW 8 13631811 missense possibly damaging 0.90
Poncha_pass UTSW 8 13595373 missense possibly damaging 0.46
Ute UTSW 8 13582381 splice site probably benign
PIT4531001:Rasa3 UTSW 8 13605887 missense probably benign 0.11
R0193:Rasa3 UTSW 8 13570233 splice site probably null
R0710:Rasa3 UTSW 8 13583830 missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13580118 splice site probably benign
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13582372 missense probably benign 0.44
R1828:Rasa3 UTSW 8 13585035 missense probably benign 0.02
R1895:Rasa3 UTSW 8 13631768 splice site probably benign
R2090:Rasa3 UTSW 8 13582381 splice site probably benign
R2374:Rasa3 UTSW 8 13577411 missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13595373 missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13588972 missense probably benign
R3899:Rasa3 UTSW 8 13578635 missense probably benign 0.21
R4230:Rasa3 UTSW 8 13570264 missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13614532 critical splice donor site probably null
R4281:Rasa3 UTSW 8 13588946 missense probably benign 0.01
R4498:Rasa3 UTSW 8 13614587 missense probably benign 0.01
R4558:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13588865 missense probably null 0.00
R4702:Rasa3 UTSW 8 13570394 missense probably benign 0.09
R4772:Rasa3 UTSW 8 13598289 missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13577501 missense probably benign 0.07
R4807:Rasa3 UTSW 8 13614633 missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13584959 nonsense probably null
R5043:Rasa3 UTSW 8 13570368 missense possibly damaging 0.59
R5435:Rasa3 UTSW 8 13631811 missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13598251 missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13580037 missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13585029 missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13631826 missense probably benign 0.29
R7100:Rasa3 UTSW 8 13586897 missense probably benign 0.02
R7322:Rasa3 UTSW 8 13595857 missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13595353 missense probably benign 0.03
R7478:Rasa3 UTSW 8 13614605 missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13590201 critical splice donor site probably null
R7554:Rasa3 UTSW 8 13595390 missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13595887 missense possibly damaging 0.73
R7641:Rasa3 UTSW 8 13584961 missense probably benign 0.11
R7667:Rasa3 UTSW 8 13588015 missense probably benign 0.27
R7751:Rasa3 UTSW 8 13568708 missense probably benign 0.18
R7999:Rasa3 UTSW 8 13631805 missense probably benign 0.04
R8039:Rasa3 UTSW 8 13588931 missense probably damaging 1.00
R8125:Rasa3 UTSW 8 13577801 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCATACTTCAGTGCCCTGG -3'
(R):5'- CAGGTCTGCTTGTGAAGTGAC -3'

Sequencing Primer
(F):5'- CCCTGGAGAGCAGGAACATC -3'
(R):5'- GGTAGCTTGACGATATATGTGACTAC -3'
Posted On2016-08-04