Incidental Mutation 'R5352:Tmem208'
ID423843
Institutional Source Beutler Lab
Gene Symbol Tmem208
Ensembl Gene ENSMUSG00000014856
Gene Nametransmembrane protein 208
Synonyms2610030K20Rik, 1700006C06Rik, Hspc171
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105326354-105335219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105328431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000138470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000015000] [ENSMUST00000070508] [ENSMUST00000098453] [ENSMUST00000109372] [ENSMUST00000126705] [ENSMUST00000153146] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199]
Predicted Effect probably benign
Transcript: ENSMUST00000014922
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000015000
AA Change: D91G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015000
Gene: ENSMUSG00000014856
AA Change: D91G

DomainStartEndE-ValueType
Pfam:DUF788 7 171 1.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098453
AA Change: D91G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856
AA Change: D91G

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109372
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856
AA Change: D91G

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126705
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138226
Gene: ENSMUSG00000014856
AA Change: D91G

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134837
Predicted Effect probably damaging
Transcript: ENSMUST00000153146
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138470
Gene: ENSMUSG00000014856
AA Change: D91G

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Meta Mutation Damage Score 0.7402 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein which is localized in the endoplasmic reticulum (ER). The protein is linked to autophagy and ER stress. Knockdown of this gene increased autophagy and triggered ER stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Tmem208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tmem208 APN 8 105328697 splice site probably null
excited UTSW 8 105328431 missense probably damaging 1.00
R0066:Tmem208 UTSW 8 105328225 missense probably benign 0.38
R0164:Tmem208 UTSW 8 105334694 missense probably benign 0.01
R0164:Tmem208 UTSW 8 105334694 missense probably benign 0.01
R0566:Tmem208 UTSW 8 105334843 missense probably benign 0.00
R1569:Tmem208 UTSW 8 105334830 missense possibly damaging 0.66
R1860:Tmem208 UTSW 8 105334806 missense possibly damaging 0.66
R1861:Tmem208 UTSW 8 105334806 missense possibly damaging 0.66
R4836:Tmem208 UTSW 8 105328664 missense probably damaging 1.00
R5126:Tmem208 UTSW 8 105334650 missense probably benign 0.00
R6862:Tmem208 UTSW 8 105328230 critical splice donor site probably null
R7289:Tmem208 UTSW 8 105334786 missense possibly damaging 0.66
R7784:Tmem208 UTSW 8 105328833 missense possibly damaging 0.50
R8274:Tmem208 UTSW 8 105328625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTGGGCCTGGGTAAGTATC -3'
(R):5'- CACATCCTTAAGGTGCCTGC -3'

Sequencing Primer
(F):5'- CCTGGGTAAGTATCCTGGGAAAG -3'
(R):5'- CTTAAGGTGCCTGCGGGATAAAG -3'
Posted On2016-08-04