Incidental Mutation 'R5352:Kdm4d'
ID 423844
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Name lysine (K)-specific demethylase 4D
Synonyms Jmjd2d
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 14373844-14411778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14375654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 68 (I68T)
Ref Sequence ENSEMBL: ENSMUSP00000111311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
AlphaFold Q3U2K5
Predicted Effect probably damaging
Transcript: ENSMUST00000058796
AA Change: I68T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: I68T

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115647
AA Change: I68T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914
AA Change: I68T

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Meta Mutation Damage Score 0.6950 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14,375,515 (GRCm39) missense probably benign 0.10
IGL01114:Kdm4d APN 9 14,375,493 (GRCm39) missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14,375,714 (GRCm39) missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14,374,860 (GRCm39) missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14,375,850 (GRCm39) missense probably benign 0.00
IGL03276:Kdm4d APN 9 14,375,838 (GRCm39) missense probably benign 0.04
IGL03379:Kdm4d APN 9 14,375,139 (GRCm39) missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14,374,418 (GRCm39) missense probably benign
R0755:Kdm4d UTSW 9 14,375,591 (GRCm39) missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14,374,395 (GRCm39) missense probably benign
R1195:Kdm4d UTSW 9 14,374,395 (GRCm39) missense probably benign
R1195:Kdm4d UTSW 9 14,374,395 (GRCm39) missense probably benign
R1455:Kdm4d UTSW 9 14,375,691 (GRCm39) missense probably damaging 0.98
R1552:Kdm4d UTSW 9 14,375,325 (GRCm39) missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14,375,807 (GRCm39) missense probably benign 0.43
R1871:Kdm4d UTSW 9 14,375,679 (GRCm39) missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14,375,613 (GRCm39) missense probably benign 0.14
R4792:Kdm4d UTSW 9 14,374,686 (GRCm39) missense probably benign
R5113:Kdm4d UTSW 9 14,375,409 (GRCm39) missense probably damaging 1.00
R5211:Kdm4d UTSW 9 14,374,400 (GRCm39) missense probably benign 0.04
R6692:Kdm4d UTSW 9 14,374,361 (GRCm39) missense probably benign
R7014:Kdm4d UTSW 9 14,375,475 (GRCm39) missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14,375,316 (GRCm39) missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14,374,454 (GRCm39) missense probably benign 0.05
R8116:Kdm4d UTSW 9 14,375,237 (GRCm39) missense probably damaging 1.00
R8134:Kdm4d UTSW 9 14,374,532 (GRCm39) missense probably damaging 1.00
R8354:Kdm4d UTSW 9 14,375,235 (GRCm39) missense possibly damaging 0.80
R9006:Kdm4d UTSW 9 14,374,833 (GRCm39) missense probably benign 0.01
R9197:Kdm4d UTSW 9 14,375,537 (GRCm39) missense probably damaging 1.00
R9298:Kdm4d UTSW 9 14,375,336 (GRCm39) missense probably damaging 1.00
R9300:Kdm4d UTSW 9 14,375,336 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCACCATAAATCGGTGACTC -3'
(R):5'- CGAAGTCCACATGTGCTCAG -3'

Sequencing Primer
(F):5'- ATCGGTGACTCATACAGGCGATTC -3'
(R):5'- TGTGCTCAGAATCCAAATTGCAGC -3'
Posted On 2016-08-04