Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Col7a1'

423846

Institutional Source

Beutler Lab

Gene Symbol

Col7a1

Ensembl Gene

ENSMUSG00000025650

Gene Name

collagen, type VII, alpha 1

Synonyms

MMRRC Submission

042931-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108953586-108984875 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 108961411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 976 (T976P)

Ref Sequence

ENSEMBL: ENSMUSP00000107701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000026740
AA Change: T976P

SMART Domains

Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: T976P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1227	2.3e-22	PFAM
Pfam:Collagen	1244	1311	2.4e-8	PFAM
Pfam:Collagen	1294	1355	4.1e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.8e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.4e-9	PFAM
Pfam:Collagen	2025	2092	9.1e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.5e-8	PFAM
Pfam:Collagen	2364	2423	7.3e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.4e-11	PFAM
Pfam:Collagen	2516	2572	1.9e-9	PFAM
Pfam:Collagen	2560	2630	7.2e-9	PFAM
Pfam:Collagen	2605	2682	6e-9	PFAM
Pfam:Collagen	2659	2722	2e-8	PFAM
low complexity region	2745	2775	N/A	INTRINSIC
Pfam:Kunitz_BPTI	2878	2932	3.2e-19	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000112070
AA Change: T976P

SMART Domains

Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: T976P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1230	2.2e-19	PFAM
Pfam:Collagen	1244	1311	2.5e-8	PFAM
Pfam:Collagen	1294	1355	4.2e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5.1e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.9e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.5e-9	PFAM
Pfam:Collagen	2025	2092	9.4e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2195	2266	7.7e-7	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.6e-8	PFAM
Pfam:Collagen	2364	2423	7.6e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.7e-11	PFAM
Pfam:Collagen	2516	2572	2e-9	PFAM
Pfam:Collagen	2560	2630	7.4e-9	PFAM
Pfam:Collagen	2605	2682	6.2e-9	PFAM
Pfam:Collagen	2659	2722	2.1e-8	PFAM
Pfam:Collagen	2719	2778	1.6e-7	PFAM
Pfam:Kunitz_BPTI	2878	2932	1.1e-19	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Col7a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Col7a1	APN	9	108977697	nonsense	probably null
IGL01366:Col7a1	APN	9	108977119	splice site	probably benign
IGL01395:Col7a1	APN	9	108983912	unclassified	probably benign
IGL01410:Col7a1	APN	9	108964618	missense	unknown
IGL01902:Col7a1	APN	9	108977827	missense	unknown
IGL01915:Col7a1	APN	9	108955745	missense	unknown
IGL01936:Col7a1	APN	9	108967999	splice site	probably benign
IGL01943:Col7a1	APN	9	108984016	critical splice acceptor site	probably null
IGL02026:Col7a1	APN	9	108968029	missense	probably damaging	1.00
IGL02168:Col7a1	APN	9	108984075	unclassified	probably benign
IGL02504:Col7a1	APN	9	108980675	missense	unknown
IGL02510:Col7a1	APN	9	108973231	splice site	probably benign
IGL02559:Col7a1	APN	9	108973216	missense	unknown
IGL02583:Col7a1	APN	9	108962229	missense	unknown
IGL02728:Col7a1	APN	9	108984104	missense	probably benign	0.39
IGL03003:Col7a1	APN	9	108974956	critical splice donor site	probably null
IGL03096:Col7a1	APN	9	108955788	missense	unknown
IGL03122:Col7a1	APN	9	108961683	missense	unknown
IGL03212:Col7a1	APN	9	108974452	missense	unknown
IGL03240:Col7a1	APN	9	108968373	missense	probably null	1.00
IGL03355:Col7a1	APN	9	108978160	missense	unknown
olivetti	UTSW	9	108969961	missense	probably damaging	1.00
smallified	UTSW	9	108972813	critical splice donor site	probably null
underwood	UTSW	9	108968875	critical splice acceptor site	probably null
PIT4131001:Col7a1	UTSW	9	108965921	splice site	probably benign
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0078:Col7a1	UTSW	9	108974913	splice site	probably benign
R0091:Col7a1	UTSW	9	108967506	splice site	probably benign
R0126:Col7a1	UTSW	9	108969583	splice site	probably benign
R0244:Col7a1	UTSW	9	108972184	splice site	probably null
R0331:Col7a1	UTSW	9	108967502	splice site	probably benign
R0375:Col7a1	UTSW	9	108980237	missense	unknown
R0601:Col7a1	UTSW	9	108980584	splice site	probably benign
R0609:Col7a1	UTSW	9	108958147	missense	unknown
R0709:Col7a1	UTSW	9	108961548	splice site	probably benign
R0879:Col7a1	UTSW	9	108976091	splice site	probably benign
R1175:Col7a1	UTSW	9	108955334	missense	unknown
R1177:Col7a1	UTSW	9	108962441	missense	unknown
R1435:Col7a1	UTSW	9	108963273	missense	unknown
R1497:Col7a1	UTSW	9	108978825	missense	unknown
R1549:Col7a1	UTSW	9	108955966	missense	unknown
R1794:Col7a1	UTSW	9	108965928	missense	unknown
R1801:Col7a1	UTSW	9	108960997	missense	unknown
R1848:Col7a1	UTSW	9	108969565	missense	possibly damaging	0.83
R1899:Col7a1	UTSW	9	108978888	missense	unknown
R1944:Col7a1	UTSW	9	108960010	missense	unknown
R1945:Col7a1	UTSW	9	108960010	missense	unknown
R1955:Col7a1	UTSW	9	108955664	missense	unknown
R2009:Col7a1	UTSW	9	108968875	critical splice acceptor site	probably null
R2034:Col7a1	UTSW	9	108963007	missense	unknown
R3148:Col7a1	UTSW	9	108961405	missense	unknown
R3713:Col7a1	UTSW	9	108964440	nonsense	probably null
R4078:Col7a1	UTSW	9	108960991	missense	unknown
R4193:Col7a1	UTSW	9	108956672	missense	unknown
R4232:Col7a1	UTSW	9	108972813	critical splice donor site	probably null
R4528:Col7a1	UTSW	9	108959533	missense	unknown
R4771:Col7a1	UTSW	9	108971925	missense	probably damaging	0.99
R4820:Col7a1	UTSW	9	108968607	missense	possibly damaging	0.72
R4896:Col7a1	UTSW	9	108957277	missense	unknown
R4911:Col7a1	UTSW	9	108975219	missense	unknown
R4915:Col7a1	UTSW	9	108966464	missense	unknown
R4917:Col7a1	UTSW	9	108966464	missense	unknown
R5001:Col7a1	UTSW	9	108965078	critical splice donor site	probably null
R5361:Col7a1	UTSW	9	108963224	missense	unknown
R5730:Col7a1	UTSW	9	108972242	critical splice donor site	probably null
R5838:Col7a1	UTSW	9	108978143	missense	unknown
R5842:Col7a1	UTSW	9	108965815	missense	unknown
R5932:Col7a1	UTSW	9	108980211	missense	unknown
R6091:Col7a1	UTSW	9	108955334	missense	unknown
R6144:Col7a1	UTSW	9	108974080	missense	unknown
R6158:Col7a1	UTSW	9	108964603	missense	unknown
R6170:Col7a1	UTSW	9	108966443	missense	unknown
R6247:Col7a1	UTSW	9	108981062	unclassified	probably benign
R6338:Col7a1	UTSW	9	108956633	missense	unknown
R6339:Col7a1	UTSW	9	108956633	missense	unknown
R6382:Col7a1	UTSW	9	108975393	missense	unknown
R6518:Col7a1	UTSW	9	108955527	missense	unknown
R6533:Col7a1	UTSW	9	108961358	missense	unknown
R6569:Col7a1	UTSW	9	108978110	splice site	probably null
R6596:Col7a1	UTSW	9	108954341	unclassified	probably benign
R6697:Col7a1	UTSW	9	108970533	missense	probably damaging	1.00
R6753:Col7a1	UTSW	9	108958128	missense	unknown
R6849:Col7a1	UTSW	9	108975053	missense	unknown
R6915:Col7a1	UTSW	9	108967618	missense	probably benign	0.02
R6974:Col7a1	UTSW	9	108969426	missense	possibly damaging	0.82
R6991:Col7a1	UTSW	9	108983919	critical splice donor site	probably null
R7028:Col7a1	UTSW	9	108963263	nonsense	probably null
R7556:Col7a1	UTSW	9	108982465	splice site	probably null
R7571:Col7a1	UTSW	9	108982707	missense	probably null
R7815:Col7a1	UTSW	9	108969565	missense	probably damaging	0.96
R7875:Col7a1	UTSW	9	108958695	missense	unknown
R7931:Col7a1	UTSW	9	108980522	splice site	probably benign
R8016:Col7a1	UTSW	9	108958644	missense	unknown
R8038:Col7a1	UTSW	9	108957292	missense	unknown
R8049:Col7a1	UTSW	9	108975563	missense	unknown
R8098:Col7a1	UTSW	9	108956695	missense	unknown
R8103:Col7a1	UTSW	9	108975384	missense	unknown
R8128:Col7a1	UTSW	9	108955721	missense	unknown
R8268:Col7a1	UTSW	9	108972989	missense	unknown
R8274:Col7a1	UTSW	9	108969961	missense	probably damaging	1.00
R8318:Col7a1	UTSW	9	108958374	missense	unknown
R8751:Col7a1	UTSW	9	108967662	missense	possibly damaging	0.92
R8824:Col7a1	UTSW	9	108967025	missense	unknown
R9148:Col7a1	UTSW	9	108960206	missense	unknown
R9170:Col7a1	UTSW	9	108956639	missense	unknown
R9171:Col7a1	UTSW	9	108978885	missense	unknown
R9236:Col7a1	UTSW	9	108960616	missense	unknown
R9287:Col7a1	UTSW	9	108958389	missense	unknown
R9378:Col7a1	UTSW	9	108958640	nonsense	probably null
R9443:Col7a1	UTSW	9	108955991	missense	unknown
R9486:Col7a1	UTSW	9	108982328	missense	unknown
R9537:Col7a1	UTSW	9	108955352	nonsense	probably null
R9559:Col7a1	UTSW	9	108957292	missense	unknown
R9563:Col7a1	UTSW	9	108962741	missense	unknown
R9565:Col7a1	UTSW	9	108962741	missense	unknown
R9578:Col7a1	UTSW	9	108960282	missense	unknown
R9664:Col7a1	UTSW	9	108983581	missense	unknown
RF008:Col7a1	UTSW	9	108964479	missense	unknown
X0023:Col7a1	UTSW	9	108984185	unclassified	probably benign
Z1088:Col7a1	UTSW	9	108978500	splice site	silent
Z1177:Col7a1	UTSW	9	108974923	missense	unknown
Z1177:Col7a1	UTSW	9	108976051	missense	unknown
Z1177:Col7a1	UTSW	9	108984077	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTGATCTCCCAGGATGCTTCAC -3'
(R):5'- TAGGAAATACCAGGTTCCAGC -3'

Sequencing Primer
(F):5'- TCTCCCAGGATGCTTCACTAAAATG -3'
(R):5'- AATACCAGGTTCCAGCCCTGTC -3'

Posted On

2016-08-04