Incidental Mutation 'R5352:Hk1'
ID 423847
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Name hexokinase 1
Synonyms mHk1-s, Hk1-s, Hk-1
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 62104634-62215687 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62140549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000111946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422] [ENSMUST00000139228] [ENSMUST00000152761] [ENSMUST00000143179]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000072357
AA Change: S113T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: S113T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099691
AA Change: S109T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: S109T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116238
AA Change: S113T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: S113T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130422
AA Change: S108T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: S108T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139228
AA Change: S95T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118166
Gene: ENSMUSG00000037012
AA Change: S95T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 3 184 1.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142527
Predicted Effect probably benign
Transcript: ENSMUST00000152761
AA Change: S93T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117752
Gene: ENSMUSG00000037012
AA Change: S93T

DomainStartEndE-ValueType
Pfam:Hexokinase_1 2 205 5.6e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143179
SMART Domains Protein: ENSMUSP00000120151
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 5 80 5e-29 PFAM
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62,122,127 (GRCm39) nonsense probably null
IGL01108:Hk1 APN 10 62,132,487 (GRCm39) missense probably benign 0.00
IGL01810:Hk1 APN 10 62,188,884 (GRCm39) missense probably benign 0.13
IGL01950:Hk1 APN 10 62,151,173 (GRCm39) missense probably damaging 0.99
IGL02165:Hk1 APN 10 62,117,667 (GRCm39) missense probably damaging 1.00
IGL02227:Hk1 APN 10 62,116,919 (GRCm39) splice site probably benign
IGL02257:Hk1 APN 10 62,107,422 (GRCm39) missense probably benign 0.07
IGL02341:Hk1 APN 10 62,120,159 (GRCm39) missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62,131,552 (GRCm39) missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62,128,138 (GRCm39) missense probably benign 0.21
IGL02700:Hk1 APN 10 62,120,590 (GRCm39) missense probably damaging 1.00
IGL02863:Hk1 APN 10 62,131,534 (GRCm39) missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62,107,578 (GRCm39) missense probably damaging 1.00
BB009:Hk1 UTSW 10 62,151,299 (GRCm39) missense probably damaging 1.00
BB019:Hk1 UTSW 10 62,151,299 (GRCm39) missense probably damaging 1.00
R0029:Hk1 UTSW 10 62,151,173 (GRCm39) missense probably damaging 0.99
R0436:Hk1 UTSW 10 62,135,054 (GRCm39) splice site probably benign
R0853:Hk1 UTSW 10 62,107,495 (GRCm39) nonsense probably null
R1422:Hk1 UTSW 10 62,131,873 (GRCm39) missense probably null 0.98
R1531:Hk1 UTSW 10 62,120,563 (GRCm39) missense probably damaging 1.00
R1760:Hk1 UTSW 10 62,117,678 (GRCm39) missense probably damaging 1.00
R2064:Hk1 UTSW 10 62,122,315 (GRCm39) missense probably benign 0.03
R3236:Hk1 UTSW 10 62,131,798 (GRCm39) splice site probably null
R3788:Hk1 UTSW 10 62,111,467 (GRCm39) missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62,126,098 (GRCm39) missense probably benign 0.10
R4373:Hk1 UTSW 10 62,151,319 (GRCm39) missense probably damaging 0.98
R4374:Hk1 UTSW 10 62,151,319 (GRCm39) missense probably damaging 0.98
R4377:Hk1 UTSW 10 62,151,319 (GRCm39) missense probably damaging 0.98
R4435:Hk1 UTSW 10 62,111,623 (GRCm39) missense probably damaging 1.00
R4609:Hk1 UTSW 10 62,194,194 (GRCm39) utr 5 prime probably benign
R4648:Hk1 UTSW 10 62,140,558 (GRCm39) missense probably benign 0.00
R4864:Hk1 UTSW 10 62,178,318 (GRCm39) missense probably benign 0.00
R4934:Hk1 UTSW 10 62,194,165 (GRCm39) utr 5 prime probably benign
R5110:Hk1 UTSW 10 62,122,430 (GRCm39) missense probably damaging 1.00
R5569:Hk1 UTSW 10 62,122,220 (GRCm39) missense probably benign 0.35
R5609:Hk1 UTSW 10 62,178,330 (GRCm39) missense probably benign 0.30
R5647:Hk1 UTSW 10 62,111,523 (GRCm39) missense probably damaging 0.99
R5750:Hk1 UTSW 10 62,110,245 (GRCm39) missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62,122,228 (GRCm39) missense probably benign
R5832:Hk1 UTSW 10 62,128,144 (GRCm39) missense probably benign 0.17
R5905:Hk1 UTSW 10 62,188,837 (GRCm39) missense probably null 0.82
R5933:Hk1 UTSW 10 62,105,773 (GRCm39) missense probably damaging 1.00
R6028:Hk1 UTSW 10 62,188,837 (GRCm39) missense probably null 0.82
R6196:Hk1 UTSW 10 62,135,038 (GRCm39) missense probably damaging 1.00
R6314:Hk1 UTSW 10 62,128,223 (GRCm39) missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62,127,757 (GRCm39) missense probably benign
R6801:Hk1 UTSW 10 62,116,910 (GRCm39) missense probably damaging 0.97
R6838:Hk1 UTSW 10 62,107,437 (GRCm39) missense probably damaging 0.98
R7045:Hk1 UTSW 10 62,122,349 (GRCm39) missense probably damaging 1.00
R7420:Hk1 UTSW 10 62,105,761 (GRCm39) missense probably damaging 1.00
R7491:Hk1 UTSW 10 62,131,524 (GRCm39) missense probably damaging 1.00
R7527:Hk1 UTSW 10 62,140,561 (GRCm39) missense probably damaging 0.99
R7561:Hk1 UTSW 10 62,116,807 (GRCm39) splice site probably null
R7932:Hk1 UTSW 10 62,151,299 (GRCm39) missense probably damaging 1.00
R8031:Hk1 UTSW 10 62,132,478 (GRCm39) missense probably benign 0.15
R8128:Hk1 UTSW 10 62,117,622 (GRCm39) missense probably benign
R8204:Hk1 UTSW 10 62,132,523 (GRCm39) missense probably damaging 1.00
R8294:Hk1 UTSW 10 62,131,624 (GRCm39) missense probably benign 0.00
R8685:Hk1 UTSW 10 62,132,453 (GRCm39) splice site probably benign
R8865:Hk1 UTSW 10 62,151,294 (GRCm39) missense probably benign 0.00
R9015:Hk1 UTSW 10 62,128,118 (GRCm39) missense possibly damaging 0.95
R9022:Hk1 UTSW 10 62,105,768 (GRCm39) missense probably damaging 1.00
R9063:Hk1 UTSW 10 62,122,429 (GRCm39) missense probably damaging 1.00
R9404:Hk1 UTSW 10 62,131,859 (GRCm39) missense possibly damaging 0.76
X0018:Hk1 UTSW 10 62,111,485 (GRCm39) missense probably benign 0.02
X0063:Hk1 UTSW 10 62,111,483 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGACCTCCAATAGAGTCCTG -3'
(R):5'- TGGGTCCAGAGTTGTTCCAG -3'

Sequencing Primer
(F):5'- ACCTCCAATAGAGTCCTGGAGGG -3'
(R):5'- TAGCAGACTGGCCAGATCC -3'
Posted On 2016-08-04