Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Hk1'

423847

Institutional Source

Beutler Lab

Gene Symbol

Hk1

Ensembl Gene

ENSMUSG00000037012

Gene Name

hexokinase 1

Synonyms

mHk1-s, Hk-1, Hk1-s

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.486) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62268855-62379908 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62304770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 113 (S113T)

Ref Sequence

ENSEMBL: ENSMUSP00000111946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422] [ENSMUST00000139228] [ENSMUST00000143179] [ENSMUST00000152761]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072357
AA Change: S113T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: S113T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	25	224	1.2e-70	PFAM
Pfam:Hexokinase_2	229	486	8e-79	PFAM
Pfam:Hexokinase_1	496	695	7e-76	PFAM
Pfam:Hexokinase_2	700	934	4.2e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099691
AA Change: S109T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: S109T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	16	221	1.9e-86	PFAM
Pfam:Hexokinase_2	223	462	1e-102	PFAM
Pfam:Hexokinase_1	464	669	1.1e-90	PFAM
Pfam:Hexokinase_2	671	910	2.2e-109	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000116238
AA Change: S113T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: S113T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	21	225	1.3e-85	PFAM
Pfam:Hexokinase_2	227	357	3.6e-56	PFAM
Pfam:Hexokinase_2	362	489	9.3e-41	PFAM
Pfam:Hexokinase_1	491	696	2e-90	PFAM
Pfam:Hexokinase_2	698	937	3.8e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130422
AA Change: S108T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: S108T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	16	220	1.4e-85	PFAM
Pfam:Hexokinase_2	222	461	1e-102	PFAM
Pfam:Hexokinase_1	463	668	1.1e-90	PFAM
Pfam:Hexokinase_2	670	909	2.2e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139228
AA Change: S95T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118166
Gene: ENSMUSG00000037012
AA Change: S95T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	3	184	1.4e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142527

Predicted Effect

probably benign
Transcript: ENSMUST00000143179

SMART Domains

Protein: ENSMUSP00000120151
Gene: ENSMUSG00000037012

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	5	80	5e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152761
AA Change: S93T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000117752
Gene: ENSMUSG00000037012
AA Change: S93T

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	2	205	5.6e-88	PFAM

Meta Mutation Damage Score

0.1116

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Hk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Hk1	APN	10	62286348	nonsense	probably null
IGL01108:Hk1	APN	10	62296708	missense	probably benign	0.00
IGL01810:Hk1	APN	10	62353105	missense	probably benign	0.13
IGL01950:Hk1	APN	10	62315394	missense	probably damaging	0.99
IGL02165:Hk1	APN	10	62281888	missense	probably damaging	1.00
IGL02227:Hk1	APN	10	62281140	splice site	probably benign
IGL02257:Hk1	APN	10	62271643	missense	probably benign	0.07
IGL02341:Hk1	APN	10	62284380	missense	possibly damaging	0.54
IGL02553:Hk1	APN	10	62295773	missense	possibly damaging	0.71
IGL02623:Hk1	APN	10	62292359	missense	probably benign	0.21
IGL02700:Hk1	APN	10	62284811	missense	probably damaging	1.00
IGL02863:Hk1	APN	10	62295755	missense	possibly damaging	0.83
IGL03002:Hk1	APN	10	62271799	missense	probably damaging	1.00
BB009:Hk1	UTSW	10	62315520	missense	probably damaging	1.00
BB019:Hk1	UTSW	10	62315520	missense	probably damaging	1.00
R0029:Hk1	UTSW	10	62315394	missense	probably damaging	0.99
R0436:Hk1	UTSW	10	62299275	splice site	probably benign
R0853:Hk1	UTSW	10	62271716	nonsense	probably null
R1422:Hk1	UTSW	10	62296094	missense	probably null	0.98
R1531:Hk1	UTSW	10	62284784	missense	probably damaging	1.00
R1760:Hk1	UTSW	10	62281899	missense	probably damaging	1.00
R2064:Hk1	UTSW	10	62286536	missense	probably benign	0.03
R3236:Hk1	UTSW	10	62296019	splice site	probably null
R3788:Hk1	UTSW	10	62275688	missense	possibly damaging	0.85
R3977:Hk1	UTSW	10	62290319	missense	probably benign	0.10
R4373:Hk1	UTSW	10	62315540	missense	probably damaging	0.98
R4374:Hk1	UTSW	10	62315540	missense	probably damaging	0.98
R4377:Hk1	UTSW	10	62315540	missense	probably damaging	0.98
R4435:Hk1	UTSW	10	62275844	missense	probably damaging	1.00
R4609:Hk1	UTSW	10	62358415	utr 5 prime	probably benign
R4648:Hk1	UTSW	10	62304779	missense	probably benign	0.00
R4864:Hk1	UTSW	10	62342539	missense	probably benign	0.00
R4934:Hk1	UTSW	10	62358386	utr 5 prime	probably benign
R5110:Hk1	UTSW	10	62286651	missense	probably damaging	1.00
R5569:Hk1	UTSW	10	62286441	missense	probably benign	0.35
R5609:Hk1	UTSW	10	62342551	missense	probably benign	0.30
R5647:Hk1	UTSW	10	62275744	missense	probably damaging	0.99
R5750:Hk1	UTSW	10	62274466	missense	possibly damaging	0.86
R5770:Hk1	UTSW	10	62286449	missense	probably benign
R5832:Hk1	UTSW	10	62292365	missense	probably benign	0.17
R5905:Hk1	UTSW	10	62353058	missense	probably null	0.82
R5933:Hk1	UTSW	10	62269994	missense	probably damaging	1.00
R6028:Hk1	UTSW	10	62353058	missense	probably null	0.82
R6196:Hk1	UTSW	10	62299259	missense	probably damaging	1.00
R6314:Hk1	UTSW	10	62292444	missense	possibly damaging	0.93
R6372:Hk1	UTSW	10	62291978	missense	probably benign
R6801:Hk1	UTSW	10	62281131	missense	probably damaging	0.97
R6838:Hk1	UTSW	10	62271658	missense	probably damaging	0.98
R7045:Hk1	UTSW	10	62286570	missense	probably damaging	1.00
R7420:Hk1	UTSW	10	62269982	missense	probably damaging	1.00
R7491:Hk1	UTSW	10	62295745	missense	probably damaging	1.00
R7527:Hk1	UTSW	10	62304782	missense	probably damaging	0.99
R7561:Hk1	UTSW	10	62281028	splice site	probably null
R7932:Hk1	UTSW	10	62315520	missense	probably damaging	1.00
R8031:Hk1	UTSW	10	62296699	missense	probably benign	0.15
R8128:Hk1	UTSW	10	62281843	missense	probably benign
R8204:Hk1	UTSW	10	62296744	missense	probably damaging	1.00
R8294:Hk1	UTSW	10	62295845	missense	probably benign	0.00
R8685:Hk1	UTSW	10	62296674	splice site	probably benign
R8865:Hk1	UTSW	10	62315515	missense	probably benign	0.00
R9015:Hk1	UTSW	10	62292339	missense	possibly damaging	0.95
R9022:Hk1	UTSW	10	62269989	missense	probably damaging	1.00
R9063:Hk1	UTSW	10	62286650	missense	probably damaging	1.00
R9404:Hk1	UTSW	10	62296080	missense	possibly damaging	0.76
X0018:Hk1	UTSW	10	62275706	missense	probably benign	0.02
X0063:Hk1	UTSW	10	62275704	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCAGACCTCCAATAGAGTCCTG -3'
(R):5'- TGGGTCCAGAGTTGTTCCAG -3'

Sequencing Primer
(F):5'- ACCTCCAATAGAGTCCTGGAGGG -3'
(R):5'- TAGCAGACTGGCCAGATCC -3'

Posted On

2016-08-04