Incidental Mutation 'R5352:Btnl9'
ID 423850
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Name butyrophilin-like 9
Synonyms D330012D11Rik
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 49059152-49077916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49069667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 204 (N204S)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531] [ENSMUST00000153999]
AlphaFold Q8BJE2
Predicted Effect probably benign
Transcript: ENSMUST00000046522
AA Change: N204S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283
AA Change: N204S

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066531
AA Change: N204S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: N204S

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128462
Predicted Effect probably benign
Transcript: ENSMUST00000153999
SMART Domains Protein: ENSMUSP00000120530
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
transmembrane domain 165 187 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49,066,518 (GRCm39) missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49,071,409 (GRCm39) missense probably benign 0.00
IGL02129:Btnl9 APN 11 49,060,100 (GRCm39) missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49,071,625 (GRCm39) missense probably benign 0.27
IGL02795:Btnl9 APN 11 49,065,694 (GRCm39) splice site probably benign
IGL02889:Btnl9 APN 11 49,069,604 (GRCm39) missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49,060,008 (GRCm39) missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49,069,606 (GRCm39) missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49,060,443 (GRCm39) missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49,066,422 (GRCm39) missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49,071,574 (GRCm39) missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49,060,371 (GRCm39) missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49,066,617 (GRCm39) missense probably benign 0.06
R2000:Btnl9 UTSW 11 49,059,948 (GRCm39) missense probably benign 0.04
R2068:Btnl9 UTSW 11 49,060,390 (GRCm39) missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49,071,523 (GRCm39) missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49,061,453 (GRCm39) splice site probably null
R2229:Btnl9 UTSW 11 49,059,945 (GRCm39) missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49,060,143 (GRCm39) nonsense probably null
R2386:Btnl9 UTSW 11 49,069,602 (GRCm39) missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49,060,503 (GRCm39) missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49,060,503 (GRCm39) missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49,071,512 (GRCm39) missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49,060,434 (GRCm39) missense probably benign 0.20
R5433:Btnl9 UTSW 11 49,066,830 (GRCm39) intron probably benign
R5490:Btnl9 UTSW 11 49,060,395 (GRCm39) missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49,069,712 (GRCm39) missense probably benign 0.00
R6008:Btnl9 UTSW 11 49,073,792 (GRCm39) critical splice donor site probably null
R6770:Btnl9 UTSW 11 49,066,392 (GRCm39) splice site probably null
R7126:Btnl9 UTSW 11 49,060,082 (GRCm39) missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49,066,617 (GRCm39) missense probably benign 0.06
R7787:Btnl9 UTSW 11 49,066,866 (GRCm39) missense unknown
R7923:Btnl9 UTSW 11 49,071,565 (GRCm39) missense probably damaging 0.97
R8050:Btnl9 UTSW 11 49,066,442 (GRCm39) missense probably benign 0.25
R8558:Btnl9 UTSW 11 49,071,619 (GRCm39) missense probably benign 0.00
R8788:Btnl9 UTSW 11 49,066,614 (GRCm39) missense probably benign 0.03
R8945:Btnl9 UTSW 11 49,065,661 (GRCm39) missense probably benign 0.38
R9105:Btnl9 UTSW 11 49,066,461 (GRCm39) missense probably benign 0.29
R9656:Btnl9 UTSW 11 49,060,008 (GRCm39) missense probably damaging 0.99
X0026:Btnl9 UTSW 11 49,060,068 (GRCm39) missense probably damaging 1.00
Z1192:Btnl9 UTSW 11 49,066,805 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGGGCGAATCAACATGG -3'
(R):5'- GGAATTTTATGCATGGTGAGCC -3'

Sequencing Primer
(F):5'- GCGAATCAACATGGAGCTTTTG -3'
(R):5'- ATGCATGGTGAGCCTGATC -3'
Posted On 2016-08-04