Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Med13'

423852

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86301468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 824 (I824L)

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

AlphaFold

Q5SWW4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043624
AA Change: I824L

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: I824L

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.0709

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0197_Med13_854	UTSW	11	86307038	missense	probably benign	0.13
R0360_Med13_060	UTSW	11	86329161	splice site	probably benign
R2359_Med13_079	UTSW	11	86291035	splice site	probably benign
R3735_Med13_085	UTSW	11	86279658	missense	probably benign	0.00
R4974_Med13_508	UTSW	11	86298847	missense	probably damaging	0.98
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0208:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0734:Med13	UTSW	11	86301237	missense	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5556:Med13	UTSW	11	86327838	missense	probably benign	0.25
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6805:Med13	UTSW	11	86278796	missense	possibly damaging	0.48
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7309:Med13	UTSW	11	86291062	missense	probably benign	0.00
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
R8671:Med13	UTSW	11	86271097	missense	probably damaging	1.00
R9056:Med13	UTSW	11	86298834	nonsense	probably null
R9084:Med13	UTSW	11	86300795	missense	probably damaging	1.00
R9148:Med13	UTSW	11	86301471	missense	probably benign	0.27
R9329:Med13	UTSW	11	86298457	missense	probably benign	0.10
R9380:Med13	UTSW	11	86286772	missense	probably benign	0.42
R9515:Med13	UTSW	11	86308901	missense	probably benign	0.00
R9516:Med13	UTSW	11	86288975	missense	probably benign	0.01
R9690:Med13	UTSW	11	86278844	missense	probably damaging	1.00
R9751:Med13	UTSW	11	86299158	missense	probably damaging	1.00
R9752:Med13	UTSW	11	86283321	missense	possibly damaging	0.87
R9764:Med13	UTSW	11	86286519	missense	possibly damaging	0.89
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTGCTGTTCCAGTGAGG -3'
(R):5'- TGATGGATCTACCTGTAAACTGTC -3'

Sequencing Primer
(F):5'- CTGTTCCAGTGAGGGTGGC -3'
(R):5'- CGTAGACTCAGAAAACCACTTTTG -3'

Posted On

2016-08-04