Incidental Mutation 'R5352:Foxj1'
ID423855
Institutional Source Beutler Lab
Gene Symbol Foxj1
Ensembl Gene ENSMUSG00000034227
Gene Nameforkhead box J1
SynonymsHfh4, HFH-4, FKHL-13
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116330704-116335399 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116334079 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 154 (N154S)
Ref Sequence ENSEMBL: ENSMUSP00000038351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036215] [ENSMUST00000100202] [ENSMUST00000106398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036215
AA Change: N154S

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038351
Gene: ENSMUSG00000034227
AA Change: N154S

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
FH 119 209 3.8e-56 SMART
low complexity region 246 271 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 316 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100202
SMART Domains Protein: ENSMUSP00000097776
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106398
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137264
Predicted Effect probably benign
Transcript: ENSMUST00000149147
SMART Domains Protein: ENSMUSP00000122483
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 102 140 5.64e-4 SMART
low complexity region 170 183 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150775
SMART Domains Protein: ENSMUSP00000123289
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.4381 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead family of transcription factors. Similar genes in zebrafish and mouse have been shown to regulate the transcription of genes that control the production of motile cilia. The mouse ortholog also functions in the determination of left-right asymmetry. Polymorphisms in this gene are associated with systemic lupus erythematosus and allergic rhinitis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Animals homozygous for targeted mutations in this gene exhibit random determination of left-right asymmetry and defective ciliogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Foxj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Foxj1 APN 11 116331920 missense possibly damaging 0.68
IGL02416:Foxj1 APN 11 116332003 missense probably benign
R0386:Foxj1 UTSW 11 116331803 missense possibly damaging 0.95
R0615:Foxj1 UTSW 11 116334082 missense possibly damaging 0.56
R7062:Foxj1 UTSW 11 116331993 missense probably benign
R7161:Foxj1 UTSW 11 116332408 missense probably damaging 1.00
R7190:Foxj1 UTSW 11 116332375 missense possibly damaging 0.90
R7399:Foxj1 UTSW 11 116332254 missense possibly damaging 0.94
R8016:Foxj1 UTSW 11 116331849 missense probably damaging 1.00
R8283:Foxj1 UTSW 11 116334067 missense probably benign 0.00
Z1177:Foxj1 UTSW 11 116332267 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTTCGTCTGTACCTCCAGG -3'
(R):5'- ATCGTCGTGCACATCTCGAAG -3'

Sequencing Primer
(F):5'- AGCAGTTTCAGAACCTGGC -3'
(R):5'- ACATCTCGAAGCGCGCC -3'
Posted On2016-08-04