Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Dnal1'

423858

Institutional Source

Beutler Lab

Gene Symbol

Dnal1

Ensembl Gene

ENSMUSG00000042523

Gene Name

dynein, axonemal, light chain 1

Synonyms

Dnal1, E330027P08Rik, 1700010H15Rik, Dnalc1

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84114366-84147498 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84136548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 27 (V27A)

Ref Sequence

ENSEMBL: ENSMUSP00000121131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046340] [ENSMUST00000123491] [ENSMUST00000136159] [ENSMUST00000140812] [ENSMUST00000156138]

AlphaFold

Q05A62

Predicted Effect

probably benign
Transcript: ENSMUST00000046340
AA Change: V109A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000037076
Gene: ENSMUSG00000042523
AA Change: V109A

Domain	Start	End	E-Value	Type
Pfam:LRR_1	32	52	8.1e-2	PFAM
Pfam:LRR_4	54	96	3.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123491
AA Change: V148A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523
AA Change: V148A

Domain	Start	End	E-Value	Type
Pfam:LRR_4	93	135	1.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136159

SMART Domains

Protein: ENSMUSP00000123497
Gene: ENSMUSG00000042523

Domain	Start	End	E-Value	Type
PDB:1DS9\|A	1	98	3e-28	PDB
SCOP:d1h6ta2	11	88	5e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140812
AA Change: V27A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121131
Gene: ENSMUSG00000042523
AA Change: V27A

Domain	Start	End	E-Value	Type
PDB:1DS9\|A	1	55	9e-8	PDB
SCOP:d1dcea3	1	56	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143753

Predicted Effect

probably benign
Transcript: ENSMUST00000156138

SMART Domains

Protein: ENSMUSP00000118584
Gene: ENSMUSG00000042523

Domain	Start	End	E-Value	Type
PDB:1M9L\|A	1	50	1e-11	PDB

Meta Mutation Damage Score

0.0797

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Dnal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02683:Dnal1	APN	12	84138354	missense	probably damaging	0.98
IGL02811:Dnal1	APN	12	84131392	splice site	probably null
IGL03412:Dnal1	APN	12	84135667	start codon destroyed	probably null	1.00
R2421:Dnal1	UTSW	12	84136706	nonsense	probably null
R4591:Dnal1	UTSW	12	84133853	missense	probably benign	0.00
R4667:Dnal1	UTSW	12	84136700	intron	probably benign
R5922:Dnal1	UTSW	12	84126972	missense	probably damaging	0.99
R7334:Dnal1	UTSW	12	84127006	missense	probably damaging	1.00
R7450:Dnal1	UTSW	12	84124523	missense	probably benign	0.11
R7529:Dnal1	UTSW	12	84131343	missense	probably benign
R7585:Dnal1	UTSW	12	84124493	missense	probably benign	0.00
R8169:Dnal1	UTSW	12	84124556	missense	probably benign	0.00
R8365:Dnal1	UTSW	12	84131389	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGGTTTTCACACACCCCAG -3'
(R):5'- GGAATTCTAGGCTTGTCTAGACTG -3'

Sequencing Primer
(F):5'- GTGGTAAAGCTTCTCTTAATCTTGAG -3'
(R):5'- GTCTAGACTGGTAAGATGACCTCC -3'

Posted On

2016-08-04