Incidental Mutation 'R5352:Dnal1'
ID423858
Institutional Source Beutler Lab
Gene Symbol Dnal1
Ensembl Gene ENSMUSG00000042523
Gene Namedynein, axonemal, light chain 1
SynonymsDnal1, E330027P08Rik, 1700010H15Rik, Dnalc1
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84114366-84147498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84136548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000121131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046340] [ENSMUST00000123491] [ENSMUST00000136159] [ENSMUST00000140812] [ENSMUST00000156138]
Predicted Effect probably benign
Transcript: ENSMUST00000046340
AA Change: V109A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037076
Gene: ENSMUSG00000042523
AA Change: V109A

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.1e-2 PFAM
Pfam:LRR_4 54 96 3.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123491
AA Change: V148A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523
AA Change: V148A

DomainStartEndE-ValueType
Pfam:LRR_4 93 135 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136159
SMART Domains Protein: ENSMUSP00000123497
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1DS9|A 1 98 3e-28 PDB
SCOP:d1h6ta2 11 88 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140812
AA Change: V27A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121131
Gene: ENSMUSG00000042523
AA Change: V27A

DomainStartEndE-ValueType
PDB:1DS9|A 1 55 9e-8 PDB
SCOP:d1dcea3 1 56 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143753
Predicted Effect probably benign
Transcript: ENSMUST00000156138
SMART Domains Protein: ENSMUSP00000118584
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1M9L|A 1 50 1e-11 PDB
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Dnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Dnal1 APN 12 84138354 missense probably damaging 0.98
IGL02811:Dnal1 APN 12 84131392 splice site probably null
IGL03412:Dnal1 APN 12 84135667 start codon destroyed probably null 1.00
R2421:Dnal1 UTSW 12 84136706 nonsense probably null
R4591:Dnal1 UTSW 12 84133853 missense probably benign 0.00
R4667:Dnal1 UTSW 12 84136700 intron probably benign
R5922:Dnal1 UTSW 12 84126972 missense probably damaging 0.99
R7334:Dnal1 UTSW 12 84127006 missense probably damaging 1.00
R7450:Dnal1 UTSW 12 84124523 missense probably benign 0.11
R7529:Dnal1 UTSW 12 84131343 missense probably benign
R7585:Dnal1 UTSW 12 84124493 missense probably benign 0.00
R8169:Dnal1 UTSW 12 84124556 missense probably benign 0.00
R8365:Dnal1 UTSW 12 84131389 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGTTTTCACACACCCCAG -3'
(R):5'- GGAATTCTAGGCTTGTCTAGACTG -3'

Sequencing Primer
(F):5'- GTGGTAAAGCTTCTCTTAATCTTGAG -3'
(R):5'- GTCTAGACTGGTAAGATGACCTCC -3'
Posted On2016-08-04