Incidental Mutation 'R5352:Agtpbp1'
ID 423859
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene Name ATP/GTP binding protein 1
Synonyms 2310001G17Rik, Ccp1, Nna1, 4930445M19Rik, 1700020N17Rik, 2900054O13Rik, 5730402G09Rik, atms
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.815) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 59597348-59705184 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59621560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 41 (T41M)
Ref Sequence ENSEMBL: ENSMUSP00000153569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000224397] [ENSMUST00000170555]
AlphaFold Q641K1
Predicted Effect probably damaging
Transcript: ENSMUST00000022040
AA Change: T984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: T984M

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163149
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164215
AA Change: T984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: T984M

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000168141
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably damaging
Transcript: ENSMUST00000224397
AA Change: T41M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000170555
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59,597,986 (GRCm39) missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59,609,908 (GRCm39) missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59,652,040 (GRCm39) missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59,655,877 (GRCm39) splice site probably benign
IGL01921:Agtpbp1 APN 13 59,660,297 (GRCm39) missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59,648,275 (GRCm39) missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59,648,303 (GRCm39) missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59,676,233 (GRCm39) missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59,630,415 (GRCm39) missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59,622,403 (GRCm39) missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59,679,894 (GRCm39) splice site probably benign
IGL03218:Agtpbp1 APN 13 59,648,021 (GRCm39) missense possibly damaging 0.94
bobs UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
drunk UTSW 13 59,660,136 (GRCm39) critical splice donor site probably benign
gru UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
rio UTSW 13 59,673,055 (GRCm39) critical splice acceptor site probably benign
shreds UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
Unfocused UTSW 13 59,609,884 (GRCm39) nonsense probably null
wobble UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59,609,845 (GRCm39) missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R0559:Agtpbp1 UTSW 13 59,644,814 (GRCm39) missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59,681,753 (GRCm39) intron probably benign
R0943:Agtpbp1 UTSW 13 59,648,416 (GRCm39) missense probably benign
R1196:Agtpbp1 UTSW 13 59,598,132 (GRCm39) unclassified probably benign
R1421:Agtpbp1 UTSW 13 59,643,389 (GRCm39) missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59,648,448 (GRCm39) splice site probably null
R1833:Agtpbp1 UTSW 13 59,613,797 (GRCm39) critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59,598,016 (GRCm39) missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59,678,872 (GRCm39) missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59,678,872 (GRCm39) missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59,623,617 (GRCm39) frame shift probably null
R2006:Agtpbp1 UTSW 13 59,648,135 (GRCm39) missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59,622,383 (GRCm39) missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59,644,829 (GRCm39) missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59,608,410 (GRCm39) missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59,648,221 (GRCm39) missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59,676,213 (GRCm39) missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59,647,886 (GRCm39) missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59,648,386 (GRCm39) missense probably benign
R4969:Agtpbp1 UTSW 13 59,648,392 (GRCm39) missense probably benign
R5066:Agtpbp1 UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59,648,027 (GRCm39) missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59,648,453 (GRCm39) missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59,621,557 (GRCm39) missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59,630,394 (GRCm39) missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59,648,329 (GRCm39) missense probably benign
R5824:Agtpbp1 UTSW 13 59,613,913 (GRCm39) missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59,681,860 (GRCm39) nonsense probably null
R6109:Agtpbp1 UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59,598,114 (GRCm39) missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59,647,834 (GRCm39) missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59,624,854 (GRCm39) missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59,692,167 (GRCm39) splice site probably null
R6950:Agtpbp1 UTSW 13 59,598,080 (GRCm39) missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59,652,108 (GRCm39) missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59,613,852 (GRCm39) missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59,680,994 (GRCm39) missense possibly damaging 0.83
R7535:Agtpbp1 UTSW 13 59,652,067 (GRCm39) missense probably benign
R7683:Agtpbp1 UTSW 13 59,660,312 (GRCm39) missense probably damaging 1.00
R7713:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R8081:Agtpbp1 UTSW 13 59,676,221 (GRCm39) nonsense probably null
R8210:Agtpbp1 UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
R8861:Agtpbp1 UTSW 13 59,643,287 (GRCm39) missense probably damaging 1.00
R9163:Agtpbp1 UTSW 13 59,609,884 (GRCm39) nonsense probably null
R9199:Agtpbp1 UTSW 13 59,613,808 (GRCm39) missense probably benign 0.00
R9389:Agtpbp1 UTSW 13 59,613,884 (GRCm39) missense probably damaging 1.00
R9414:Agtpbp1 UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
R9435:Agtpbp1 UTSW 13 59,622,429 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGAGGAATGTCAGTCTGCATG -3'
(R):5'- GAAAAGCCCAGAATTGACACTG -3'

Sequencing Primer
(F):5'- AATGTCAGTCTGCATGCTAGTGC -3'
(R):5'- GACATCGGATTTTCCATGTAGC -3'
Posted On 2016-08-04