Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Agtpbp1'

423859

Institutional Source

Beutler Lab

Gene Symbol

Agtpbp1

Ensembl Gene

ENSMUSG00000021557

Gene Name

ATP/GTP binding protein 1

Synonyms

2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik

MMRRC Submission

042931-MU

Accession Numbers

Genbank: NM_023328; MGI: 2159437

Essential gene?

Possibly essential (E-score: 0.707) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59445742-59585227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 59473746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 41 (T41M)

Ref Sequence

ENSEMBL: ENSMUSP00000153569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]

AlphaFold

Q641K1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022040
AA Change: T984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: T984M

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163149

SMART Domains

Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164215
AA Change: T984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: T984M

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165477

Predicted Effect

probably benign
Transcript: ENSMUST00000168141

Predicted Effect

probably benign
Transcript: ENSMUST00000169745

Predicted Effect

probably benign
Transcript: ENSMUST00000170555

SMART Domains

Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224397
AA Change: T41M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Agtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Agtpbp1	APN	13	59450172	missense	probably damaging	1.00
IGL00808:Agtpbp1	APN	13	59462094	missense	possibly damaging	0.84
IGL01298:Agtpbp1	APN	13	59504226	missense	possibly damaging	0.77
IGL01628:Agtpbp1	APN	13	59508063	splice site	probably benign
IGL01921:Agtpbp1	APN	13	59512483	missense	possibly damaging	0.71
IGL02189:Agtpbp1	APN	13	59500461	missense	probably benign	0.01
IGL02325:Agtpbp1	APN	13	59500489	missense	probably benign	0.01
IGL02700:Agtpbp1	APN	13	59528419	missense	probably damaging	1.00
IGL02821:Agtpbp1	APN	13	59482601	missense	possibly damaging	0.69
IGL03130:Agtpbp1	APN	13	59474589	missense	possibly damaging	0.73
IGL03167:Agtpbp1	APN	13	59532080	splice site	probably benign
IGL03218:Agtpbp1	APN	13	59500207	missense	possibly damaging	0.94
bobs	UTSW	13	59482571	missense	possibly damaging	0.53
drunk	UTSW	13	59512323	critical splice donor site	probably benign
gru	UTSW	13	59473746	missense	probably damaging	1.00
rio	UTSW	13	59525241	critical splice acceptor site	probably benign
shreds	UTSW	13	59462088	missense	probably damaging	1.00
Unfocused	UTSW	13	59462070	nonsense	probably null
wobble	UTSW	13	59474550	missense	probably damaging	1.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0276:Agtpbp1	UTSW	13	59462031	missense	possibly damaging	0.93
R0413:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R0559:Agtpbp1	UTSW	13	59497000	missense	probably benign	0.32
R0848:Agtpbp1	UTSW	13	59533939	intron	probably benign
R0943:Agtpbp1	UTSW	13	59500602	missense	probably benign
R1196:Agtpbp1	UTSW	13	59450318	unclassified	probably benign
R1421:Agtpbp1	UTSW	13	59495575	missense	possibly damaging	0.86
R1531:Agtpbp1	UTSW	13	59500634	splice site	probably null
R1833:Agtpbp1	UTSW	13	59465983	critical splice donor site	probably null
R1864:Agtpbp1	UTSW	13	59450202	missense	possibly damaging	0.92
R1994:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R1995:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R2001:Agtpbp1	UTSW	13	59475803	frame shift	probably null
R2006:Agtpbp1	UTSW	13	59500321	missense	probably benign	0.00
R2397:Agtpbp1	UTSW	13	59474569	missense	probably benign	0.10
R2918:Agtpbp1	UTSW	13	59497015	missense	possibly damaging	0.90
R3873:Agtpbp1	UTSW	13	59460596	missense	possibly damaging	0.88
R3924:Agtpbp1	UTSW	13	59500407	missense	probably benign	0.01
R4649:Agtpbp1	UTSW	13	59528399	missense	possibly damaging	0.89
R4913:Agtpbp1	UTSW	13	59500072	missense	probably damaging	1.00
R4933:Agtpbp1	UTSW	13	59500572	missense	probably benign
R4969:Agtpbp1	UTSW	13	59500578	missense	probably benign
R5066:Agtpbp1	UTSW	13	59474550	missense	probably damaging	1.00
R5139:Agtpbp1	UTSW	13	59500213	missense	probably damaging	0.99
R5194:Agtpbp1	UTSW	13	59500639	missense	probably benign	0.19
R5269:Agtpbp1	UTSW	13	59473743	missense	probably damaging	1.00
R5558:Agtpbp1	UTSW	13	59482580	missense	probably benign	0.05
R5687:Agtpbp1	UTSW	13	59500515	missense	probably benign
R5824:Agtpbp1	UTSW	13	59466099	missense	probably damaging	1.00
R5979:Agtpbp1	UTSW	13	59534046	nonsense	probably null
R6109:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R6264:Agtpbp1	UTSW	13	59450300	missense	possibly damaging	0.89
R6413:Agtpbp1	UTSW	13	59500020	missense	possibly damaging	0.90
R6498:Agtpbp1	UTSW	13	59477040	missense	possibly damaging	0.71
R6747:Agtpbp1	UTSW	13	59544353	splice site	probably null
R6950:Agtpbp1	UTSW	13	59450266	missense	probably benign	0.32
R7030:Agtpbp1	UTSW	13	59504294	missense	probably damaging	1.00
R7180:Agtpbp1	UTSW	13	59466038	missense	probably benign	0.11
R7196:Agtpbp1	UTSW	13	59533180	missense	possibly damaging	0.83
R7535:Agtpbp1	UTSW	13	59504253	missense	probably benign
R7683:Agtpbp1	UTSW	13	59512498	missense	probably damaging	1.00
R7713:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R8081:Agtpbp1	UTSW	13	59528407	nonsense	probably null
R8210:Agtpbp1	UTSW	13	59482571	missense	possibly damaging	0.53
R8861:Agtpbp1	UTSW	13	59495473	missense	probably damaging	1.00
R9163:Agtpbp1	UTSW	13	59462070	nonsense	probably null
R9199:Agtpbp1	UTSW	13	59465994	missense	probably benign	0.00
R9389:Agtpbp1	UTSW	13	59466070	missense	probably damaging	1.00
R9414:Agtpbp1	UTSW	13	59462088	missense	probably damaging	1.00
R9435:Agtpbp1	UTSW	13	59474615	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GGAGGAATGTCAGTCTGCATG -3'
(R):5'- GAAAAGCCCAGAATTGACACTG -3'

Sequencing Primer
(F):5'- AATGTCAGTCTGCATGCTAGTGC -3'
(R):5'- GACATCGGATTTTCCATGTAGC -3'

Posted On

2016-08-04