Incidental Mutation 'R5352:Pdxdc1'
ID 423867
Institutional Source Beutler Lab
Gene Symbol Pdxdc1
Ensembl Gene ENSMUSG00000022680
Gene Name pyridoxal-dependent decarboxylase domain containing 1
Synonyms 2210010A19Rik
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13651012-13720995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13658175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 516 (N516S)
Ref Sequence ENSEMBL: ENSMUSP00000023361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023361] [ENSMUST00000023362] [ENSMUST00000115804] [ENSMUST00000115805]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023361
AA Change: N516S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023361
Gene: ENSMUSG00000022680
AA Change: N516S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 166 310 2.6e-12 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023362
SMART Domains Protein: ENSMUSP00000023362
Gene: ENSMUSG00000022681

DomainStartEndE-ValueType
Pfam:N_Asn_amidohyd 36 304 1.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115804
AA Change: N516S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111471
Gene: ENSMUSG00000022680
AA Change: N516S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 154 308 5.5e-15 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115805
SMART Domains Protein: ENSMUSP00000111472
Gene: ENSMUSG00000022681

DomainStartEndE-ValueType
Pfam:N_Asn_amidohyd 32 215 1.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148848
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Pdxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Pdxdc1 APN 16 13,677,016 (GRCm39) missense probably damaging 1.00
IGL02101:Pdxdc1 APN 16 13,687,720 (GRCm39) missense probably damaging 0.99
IGL02484:Pdxdc1 APN 16 13,693,945 (GRCm39) missense possibly damaging 0.94
IGL02523:Pdxdc1 APN 16 13,699,799 (GRCm39) missense probably damaging 1.00
IGL02560:Pdxdc1 APN 16 13,657,596 (GRCm39) missense probably benign 0.00
IGL02884:Pdxdc1 APN 16 13,661,659 (GRCm39) missense possibly damaging 0.86
IGL03008:Pdxdc1 APN 16 13,694,023 (GRCm39) missense possibly damaging 0.81
IGL03162:Pdxdc1 APN 16 13,675,281 (GRCm39) missense probably damaging 0.99
IGL02991:Pdxdc1 UTSW 16 13,675,260 (GRCm39) missense probably damaging 1.00
PIT4472001:Pdxdc1 UTSW 16 13,663,209 (GRCm39) missense probably damaging 1.00
R0015:Pdxdc1 UTSW 16 13,705,547 (GRCm39) splice site probably benign
R0240:Pdxdc1 UTSW 16 13,697,309 (GRCm39) missense probably damaging 1.00
R0240:Pdxdc1 UTSW 16 13,697,309 (GRCm39) missense probably damaging 1.00
R0432:Pdxdc1 UTSW 16 13,672,264 (GRCm39) missense probably damaging 0.97
R0846:Pdxdc1 UTSW 16 13,672,257 (GRCm39) critical splice donor site probably null
R0944:Pdxdc1 UTSW 16 13,656,233 (GRCm39) missense probably damaging 1.00
R0945:Pdxdc1 UTSW 16 13,675,296 (GRCm39) missense probably damaging 1.00
R1118:Pdxdc1 UTSW 16 13,697,278 (GRCm39) splice site probably benign
R1726:Pdxdc1 UTSW 16 13,656,164 (GRCm39) critical splice donor site probably null
R2425:Pdxdc1 UTSW 16 13,697,372 (GRCm39) missense possibly damaging 0.90
R3890:Pdxdc1 UTSW 16 13,654,312 (GRCm39) missense probably benign
R4452:Pdxdc1 UTSW 16 13,654,990 (GRCm39) missense possibly damaging 0.55
R4516:Pdxdc1 UTSW 16 13,656,210 (GRCm39) nonsense probably null
R4938:Pdxdc1 UTSW 16 13,693,933 (GRCm39) missense probably benign 0.03
R5554:Pdxdc1 UTSW 16 13,690,363 (GRCm39) missense probably benign 0.01
R7300:Pdxdc1 UTSW 16 13,697,374 (GRCm39) missense probably damaging 0.99
R7356:Pdxdc1 UTSW 16 13,677,867 (GRCm39) missense probably damaging 1.00
R7963:Pdxdc1 UTSW 16 13,694,030 (GRCm39) missense possibly damaging 0.93
R8930:Pdxdc1 UTSW 16 13,672,269 (GRCm39) missense probably damaging 1.00
R8932:Pdxdc1 UTSW 16 13,672,269 (GRCm39) missense probably damaging 1.00
Z1176:Pdxdc1 UTSW 16 13,720,907 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGAACCCTGCCGAAGTC -3'
(R):5'- TGAGAGTCACCCAGTCATCC -3'

Sequencing Primer
(F):5'- TGCCGAAGTCCAATGCTG -3'
(R):5'- GAGAGTCACCCAGTCATCCTTTAATC -3'
Posted On 2016-08-04