Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Ccnf'

423872

Institutional Source

Beutler Lab

Gene Symbol

Ccnf

Ensembl Gene

ENSMUSG00000072082

Gene Name

cyclin F

Synonyms

Fbxo1, CycF

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24223232-24251409 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 24243273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115390]

AlphaFold

P51944

Predicted Effect

probably null
Transcript: ENSMUST00000115390

SMART Domains

Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082

Domain	Start	End	E-Value	Type
FBOX	35	75	1.56e-6	SMART
CYCLIN	315	399	2.25e-13	SMART
Cyclin_C	408	531	2.58e-19	SMART
CYCLIN	416	494	2.27e-9	SMART
low complexity region	545	555	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184733

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Ccnf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Ccnf	APN	17	24225012	missense	probably damaging	1.00
IGL01942:Ccnf	APN	17	24242320	missense	probably benign	0.03
IGL02251:Ccnf	APN	17	24226539	missense	probably benign	0.00
IGL02945:Ccnf	APN	17	24224916	missense	probably damaging	0.99
IGL02952:Ccnf	APN	17	24231325	missense	possibly damaging	0.93
albuquerque	UTSW	17	24223997	nonsense	probably null
R0326:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R0891:Ccnf	UTSW	17	24226777	missense	possibly damaging	0.93
R1069:Ccnf	UTSW	17	24223997	nonsense	probably null
R1072:Ccnf	UTSW	17	24237162	missense	probably damaging	0.97
R1693:Ccnf	UTSW	17	24226540	frame shift	probably null
R2147:Ccnf	UTSW	17	24230314	critical splice donor site	probably null
R3929:Ccnf	UTSW	17	24234382	missense	probably damaging	1.00
R4081:Ccnf	UTSW	17	24223898	makesense	probably null
R4260:Ccnf	UTSW	17	24226767	missense	probably damaging	1.00
R4579:Ccnf	UTSW	17	24231329	nonsense	probably null
R4651:Ccnf	UTSW	17	24231786	missense	probably damaging	1.00
R4844:Ccnf	UTSW	17	24230357	nonsense	probably null
R4876:Ccnf	UTSW	17	24230337	missense	probably damaging	1.00
R5234:Ccnf	UTSW	17	24234437	nonsense	probably null
R5845:Ccnf	UTSW	17	24240793	missense	possibly damaging	0.95
R6084:Ccnf	UTSW	17	24231837	missense	probably damaging	1.00
R6219:Ccnf	UTSW	17	24226704	nonsense	probably null
R7021:Ccnf	UTSW	17	24242231	missense	probably damaging	1.00
R7176:Ccnf	UTSW	17	24249402	missense	possibly damaging	0.54
R7180:Ccnf	UTSW	17	24223915	missense	probably benign	0.00
R7485:Ccnf	UTSW	17	24249258	missense	probably damaging	0.97
R7763:Ccnf	UTSW	17	24225012	missense	probably damaging	1.00
R8016:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R8034:Ccnf	UTSW	17	24231831	missense	probably damaging	1.00
R8069:Ccnf	UTSW	17	24225015	missense	probably damaging	1.00
R9021:Ccnf	UTSW	17	24226705	nonsense	probably null
R9623:Ccnf	UTSW	17	24249393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATCCTTTGCCGATCCA -3'
(R):5'- CCATGCTTGAGCTAATTTTGGAT -3'

Sequencing Primer
(F):5'- CCTTTGCCGATCCAAATTAGGAAAGG -3'
(R):5'- CAGATCCTCTTGAACTGGAGTTTCAG -3'

Posted On

2016-08-04