Incidental Mutation 'R5352:Ccnf'
ID423872
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Namecyclin F
SynonymsFbxo1, CycF
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24223232-24251409 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 24243273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
Predicted Effect probably null
Transcript: ENSMUST00000115390
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184733
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24225012 missense probably damaging 1.00
IGL01942:Ccnf APN 17 24242320 missense probably benign 0.03
IGL02251:Ccnf APN 17 24226539 missense probably benign 0.00
IGL02945:Ccnf APN 17 24224916 missense probably damaging 0.99
IGL02952:Ccnf APN 17 24231325 missense possibly damaging 0.93
albuquerque UTSW 17 24223997 nonsense probably null
R0326:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24226777 missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24223997 nonsense probably null
R1072:Ccnf UTSW 17 24237162 missense probably damaging 0.97
R1693:Ccnf UTSW 17 24226540 frame shift probably null
R2147:Ccnf UTSW 17 24230314 critical splice donor site probably null
R3929:Ccnf UTSW 17 24234382 missense probably damaging 1.00
R4081:Ccnf UTSW 17 24223898 makesense probably null
R4260:Ccnf UTSW 17 24226767 missense probably damaging 1.00
R4579:Ccnf UTSW 17 24231329 nonsense probably null
R4651:Ccnf UTSW 17 24231786 missense probably damaging 1.00
R4844:Ccnf UTSW 17 24230357 nonsense probably null
R4876:Ccnf UTSW 17 24230337 missense probably damaging 1.00
R5234:Ccnf UTSW 17 24234437 nonsense probably null
R5845:Ccnf UTSW 17 24240793 missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24231837 missense probably damaging 1.00
R6219:Ccnf UTSW 17 24226704 nonsense probably null
R7021:Ccnf UTSW 17 24242231 missense probably damaging 1.00
R7176:Ccnf UTSW 17 24249402 missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24223915 missense probably benign 0.00
R7485:Ccnf UTSW 17 24249258 missense probably damaging 0.97
R7763:Ccnf UTSW 17 24225012 missense probably damaging 1.00
R8016:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24231831 missense probably damaging 1.00
R8069:Ccnf UTSW 17 24225015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATCCTTTGCCGATCCA -3'
(R):5'- CCATGCTTGAGCTAATTTTGGAT -3'

Sequencing Primer
(F):5'- CCTTTGCCGATCCAAATTAGGAAAGG -3'
(R):5'- CAGATCCTCTTGAACTGGAGTTTCAG -3'
Posted On2016-08-04