Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Uhrf1bp1'

423874

Institutional Source

Beutler Lab

Gene Symbol

Uhrf1bp1

Ensembl Gene

ENSMUSG00000039512

Gene Name

UHRF1 (ICBP90) binding protein 1

Synonyms

1110020K19Rik, F830021D11Rik

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27856490-27900040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27887515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1005 (S1005N)

Ref Sequence

ENSEMBL: ENSMUSP00000110499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114849]

AlphaFold

B2KF50

Predicted Effect

probably benign
Transcript: ENSMUST00000114849
AA Change: S1005N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: S1005N

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	1	104	2.6e-18	PFAM
low complexity region	234	247	N/A	INTRINSIC
low complexity region	297	306	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
low complexity region	1200	1216	N/A	INTRINSIC
low complexity region	1322	1333	N/A	INTRINSIC
low complexity region	1375	1386	N/A	INTRINSIC
coiled coil region	1394	1424	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137825

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Snx2	A	G	18: 53,197,925		probably null	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Uhrf1bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Uhrf1bp1	APN	17	27876917	splice site	probably benign
IGL00786:Uhrf1bp1	APN	17	27879292	missense	probably damaging	0.99
IGL01074:Uhrf1bp1	APN	17	27879291	missense	possibly damaging	0.94
IGL01780:Uhrf1bp1	APN	17	27893500	missense	probably damaging	1.00
IGL02668:Uhrf1bp1	APN	17	27886575	missense	possibly damaging	0.53
IGL02686:Uhrf1bp1	APN	17	27894589	missense	probably benign
IGL03240:Uhrf1bp1	APN	17	27893253	missense	probably benign	0.37
hades	UTSW	17	27894746	missense	probably damaging	1.00
R0167:Uhrf1bp1	UTSW	17	27880202	missense	possibly damaging	0.46
R0240:Uhrf1bp1	UTSW	17	27895870	splice site	probably benign
R0332:Uhrf1bp1	UTSW	17	27893294	critical splice donor site	probably null
R0668:Uhrf1bp1	UTSW	17	27895939	missense	probably benign	0.16
R0726:Uhrf1bp1	UTSW	17	27885489	missense	possibly damaging	0.50
R0964:Uhrf1bp1	UTSW	17	27887178	missense	probably damaging	0.96
R1125:Uhrf1bp1	UTSW	17	27893449	missense	probably damaging	1.00
R1139:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1164:Uhrf1bp1	UTSW	17	27895380	critical splice donor site	probably null
R1192:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1277:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1279:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1340:Uhrf1bp1	UTSW	17	27894721	missense	probably benign	0.00
R1341:Uhrf1bp1	UTSW	17	27877419	splice site	probably benign
R1344:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1418:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1552:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1726:Uhrf1bp1	UTSW	17	27886251	splice site	probably null
R1791:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R1796:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R2858:Uhrf1bp1	UTSW	17	27885462	missense	probably damaging	0.99
R3034:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R4111:Uhrf1bp1	UTSW	17	27886090	nonsense	probably null
R4159:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4160:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4161:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4431:Uhrf1bp1	UTSW	17	27885931	missense	probably damaging	1.00
R4575:Uhrf1bp1	UTSW	17	27887503	missense	probably benign	0.02
R4657:Uhrf1bp1	UTSW	17	27890105	missense	probably benign	0.09
R4666:Uhrf1bp1	UTSW	17	27893503	missense	possibly damaging	0.95
R4825:Uhrf1bp1	UTSW	17	27877394	missense	probably damaging	0.98
R4872:Uhrf1bp1	UTSW	17	27890136	missense	probably benign	0.10
R4956:Uhrf1bp1	UTSW	17	27889984	splice site	probably null
R4976:Uhrf1bp1	UTSW	17	27884026	missense	probably damaging	0.99
R4982:Uhrf1bp1	UTSW	17	27886606	missense	probably benign	0.05
R5017:Uhrf1bp1	UTSW	17	27894739	nonsense	probably null
R5033:Uhrf1bp1	UTSW	17	27886864	missense	probably damaging	0.99
R5137:Uhrf1bp1	UTSW	17	27876990	splice site	probably null
R5159:Uhrf1bp1	UTSW	17	27881556	missense	probably damaging	0.98
R5177:Uhrf1bp1	UTSW	17	27885018	missense	possibly damaging	0.94
R5196:Uhrf1bp1	UTSW	17	27856763	missense	probably benign	0.09
R5214:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5354:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5425:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5601:Uhrf1bp1	UTSW	17	27884494	missense	probably damaging	1.00
R6080:Uhrf1bp1	UTSW	17	27880297	missense	probably benign
R6088:Uhrf1bp1	UTSW	17	27884605	critical splice donor site	probably null
R6331:Uhrf1bp1	UTSW	17	27893201	missense	probably benign	0.01
R6529:Uhrf1bp1	UTSW	17	27879776	missense	possibly damaging	0.90
R6614:Uhrf1bp1	UTSW	17	27876925	missense	probably benign	0.18
R6701:Uhrf1bp1	UTSW	17	27887357	nonsense	probably null
R7082:Uhrf1bp1	UTSW	17	27890065	missense	probably damaging	1.00
R7158:Uhrf1bp1	UTSW	17	27886433	nonsense	probably null
R8338:Uhrf1bp1	UTSW	17	27876695	missense	probably damaging	1.00
R8914:Uhrf1bp1	UTSW	17	27886913	missense	possibly damaging	0.66
R9135:Uhrf1bp1	UTSW	17	27885928	nonsense	probably null
R9218:Uhrf1bp1	UTSW	17	27895555	missense	probably benign	0.00
R9421:Uhrf1bp1	UTSW	17	27876686	missense	probably damaging	1.00
R9495:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9514:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9621:Uhrf1bp1	UTSW	17	27886779	missense	probably benign	0.00
R9766:Uhrf1bp1	UTSW	17	27886825	missense	probably damaging	1.00
RF005:Uhrf1bp1	UTSW	17	27885531	missense	probably damaging	1.00
X0017:Uhrf1bp1	UTSW	17	27877341	missense	probably benign	0.03
Z1176:Uhrf1bp1	UTSW	17	27876676	missense	probably damaging	1.00
Z1176:Uhrf1bp1	UTSW	17	27886306	missense	probably damaging	1.00
Z1177:Uhrf1bp1	UTSW	17	27884966	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAGTCTGATGCCTCCTCAGACC -3'
(R):5'- GGCAAGGACAACATCTTGTGC -3'

Sequencing Primer
(F):5'- TGGAGAGCTACCAGACCCAG -3'
(R):5'- GCATGGTAGAAGTCATTCGATCTCTC -3'

Posted On

2016-08-04