Incidental Mutation 'R5352:Iws1'
ID 423879
Institutional Source Beutler Lab
Gene Symbol Iws1
Ensembl Gene ENSMUSG00000024384
Gene Name IWS1, SUPT6 interacting protein
Synonyms 1700069O15Rik
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 32200794-32237381 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32216457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 399 (K399M)
Ref Sequence ENSEMBL: ENSMUSP00000148514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025243] [ENSMUST00000212675]
AlphaFold Q8C1D8
Predicted Effect probably damaging
Transcript: ENSMUST00000025243
AA Change: K399M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025243
Gene: ENSMUSG00000024384
AA Change: K399M

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 73 86 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
internal_repeat_2 112 179 9.21e-13 PROSPERO
internal_repeat_1 118 184 9.82e-20 PROSPERO
internal_repeat_1 183 296 9.82e-20 PROSPERO
internal_repeat_2 229 316 9.21e-13 PROSPERO
low complexity region 320 332 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
low complexity region 384 404 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
Pfam:Med26 584 636 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212115
Predicted Effect probably benign
Transcript: ENSMUST00000212280
Predicted Effect probably benign
Transcript: ENSMUST00000212458
Predicted Effect probably damaging
Transcript: ENSMUST00000212675
AA Change: K399M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000213074
AA Change: K46M
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rp1 T C 1: 4,417,321 (GRCm39) S1264G probably benign Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Iws1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Iws1 APN 18 32,217,741 (GRCm39) missense probably benign 0.07
IGL01432:Iws1 APN 18 32,216,519 (GRCm39) splice site probably benign
IGL01647:Iws1 APN 18 32,230,275 (GRCm39) nonsense probably null
IGL02054:Iws1 APN 18 32,223,595 (GRCm39) critical splice donor site probably null
IGL02189:Iws1 APN 18 32,226,178 (GRCm39) missense probably damaging 1.00
IGL02664:Iws1 APN 18 32,203,217 (GRCm39) missense possibly damaging 0.81
IGL03384:Iws1 APN 18 32,226,203 (GRCm39) missense probably damaging 1.00
IGL03394:Iws1 APN 18 32,221,301 (GRCm39) splice site probably benign
R0352:Iws1 UTSW 18 32,217,258 (GRCm39) missense probably damaging 1.00
R1385:Iws1 UTSW 18 32,223,483 (GRCm39) missense probably benign 0.03
R1486:Iws1 UTSW 18 32,230,309 (GRCm39) missense probably damaging 1.00
R1526:Iws1 UTSW 18 32,213,178 (GRCm39) missense probably benign 0.00
R1529:Iws1 UTSW 18 32,213,334 (GRCm39) missense probably benign
R2094:Iws1 UTSW 18 32,217,719 (GRCm39) missense probably damaging 1.00
R3774:Iws1 UTSW 18 32,213,048 (GRCm39) missense probably damaging 1.00
R3907:Iws1 UTSW 18 32,212,973 (GRCm39) missense possibly damaging 0.93
R4018:Iws1 UTSW 18 32,203,205 (GRCm39) nonsense probably null
R4423:Iws1 UTSW 18 32,216,503 (GRCm39) missense probably damaging 1.00
R4703:Iws1 UTSW 18 32,213,066 (GRCm39) missense probably benign 0.19
R4979:Iws1 UTSW 18 32,226,320 (GRCm39) unclassified probably benign
R5228:Iws1 UTSW 18 32,221,314 (GRCm39) missense probably damaging 1.00
R6428:Iws1 UTSW 18 32,219,343 (GRCm39) missense probably damaging 1.00
R6846:Iws1 UTSW 18 32,219,326 (GRCm39) unclassified probably benign
R6892:Iws1 UTSW 18 32,219,327 (GRCm39) missense probably damaging 0.99
R7163:Iws1 UTSW 18 32,226,277 (GRCm39) missense possibly damaging 0.80
R7540:Iws1 UTSW 18 32,213,536 (GRCm39) missense possibly damaging 0.94
R7605:Iws1 UTSW 18 32,222,540 (GRCm39) missense probably benign 0.01
R7714:Iws1 UTSW 18 32,223,568 (GRCm39) missense probably benign 0.00
R8218:Iws1 UTSW 18 32,226,688 (GRCm39) missense probably benign 0.00
R8229:Iws1 UTSW 18 32,217,740 (GRCm39) missense probably benign
R8728:Iws1 UTSW 18 32,216,334 (GRCm39) missense probably damaging 1.00
R8987:Iws1 UTSW 18 32,226,645 (GRCm39) missense possibly damaging 0.60
R9096:Iws1 UTSW 18 32,216,373 (GRCm39) missense probably benign
R9187:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9188:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9189:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9190:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9284:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9302:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9351:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9352:Iws1 UTSW 18 32,213,213 (GRCm39) missense possibly damaging 0.68
R9572:Iws1 UTSW 18 32,203,257 (GRCm39) missense probably damaging 1.00
R9703:Iws1 UTSW 18 32,212,738 (GRCm39) missense probably damaging 0.99
R9758:Iws1 UTSW 18 32,216,347 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACGGGCCTTTAACTG -3'
(R):5'- TTTAAATTGGCCTTCCACAACC -3'

Sequencing Primer
(F):5'- GCCTTTAACTGGGCATGAATG -3'
(R):5'- GAGGTAATATGATTACTGACCCCAGC -3'
Posted On 2016-08-04