Incidental Mutation 'R5352:Iws1'
ID423879
Institutional Source Beutler Lab
Gene Symbol Iws1
Ensembl Gene ENSMUSG00000024384
Gene NameIWS1, SUPT6 interacting protein
Synonyms1700069O15Rik
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32067741-32104328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32083404 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 399 (K399M)
Ref Sequence ENSEMBL: ENSMUSP00000148514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025243] [ENSMUST00000212675]
Predicted Effect probably damaging
Transcript: ENSMUST00000025243
AA Change: K399M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025243
Gene: ENSMUSG00000024384
AA Change: K399M

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 73 86 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
internal_repeat_2 112 179 9.21e-13 PROSPERO
internal_repeat_1 118 184 9.82e-20 PROSPERO
internal_repeat_1 183 296 9.82e-20 PROSPERO
internal_repeat_2 229 316 9.21e-13 PROSPERO
low complexity region 320 332 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
low complexity region 384 404 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
Pfam:Med26 584 636 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212115
Predicted Effect probably benign
Transcript: ENSMUST00000212280
Predicted Effect probably benign
Transcript: ENSMUST00000212458
Predicted Effect probably damaging
Transcript: ENSMUST00000212675
AA Change: K399M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000213074
AA Change: K46M
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Iws1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Iws1 APN 18 32084688 missense probably benign 0.07
IGL01432:Iws1 APN 18 32083466 splice site probably benign
IGL01647:Iws1 APN 18 32097222 nonsense probably null
IGL02054:Iws1 APN 18 32090542 critical splice donor site probably null
IGL02189:Iws1 APN 18 32093125 missense probably damaging 1.00
IGL02664:Iws1 APN 18 32070164 missense possibly damaging 0.81
IGL03384:Iws1 APN 18 32093150 missense probably damaging 1.00
IGL03394:Iws1 APN 18 32088248 splice site probably benign
R0352:Iws1 UTSW 18 32084205 missense probably damaging 1.00
R1385:Iws1 UTSW 18 32090430 missense probably benign 0.03
R1486:Iws1 UTSW 18 32097256 missense probably damaging 1.00
R1526:Iws1 UTSW 18 32080125 missense probably benign 0.00
R1529:Iws1 UTSW 18 32080281 missense probably benign
R2094:Iws1 UTSW 18 32084666 missense probably damaging 1.00
R3774:Iws1 UTSW 18 32079995 missense probably damaging 1.00
R3907:Iws1 UTSW 18 32079920 missense possibly damaging 0.93
R4018:Iws1 UTSW 18 32070152 nonsense probably null
R4423:Iws1 UTSW 18 32083450 missense probably damaging 1.00
R4703:Iws1 UTSW 18 32080013 missense probably benign 0.19
R4979:Iws1 UTSW 18 32093267 unclassified probably benign
R5228:Iws1 UTSW 18 32088261 missense probably damaging 1.00
R6428:Iws1 UTSW 18 32086290 missense probably damaging 1.00
R6846:Iws1 UTSW 18 32086273 unclassified probably benign
R6892:Iws1 UTSW 18 32086274 missense probably damaging 0.99
R7163:Iws1 UTSW 18 32093224 missense possibly damaging 0.80
R7540:Iws1 UTSW 18 32080483 missense possibly damaging 0.94
R7605:Iws1 UTSW 18 32089487 missense probably benign 0.01
R7714:Iws1 UTSW 18 32090515 missense probably benign 0.00
R8218:Iws1 UTSW 18 32093635 missense probably benign 0.00
R8229:Iws1 UTSW 18 32084687 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCACGGGCCTTTAACTG -3'
(R):5'- TTTAAATTGGCCTTCCACAACC -3'

Sequencing Primer
(F):5'- GCCTTTAACTGGGCATGAATG -3'
(R):5'- GAGGTAATATGATTACTGACCCCAGC -3'
Posted On2016-08-04