Incidental Mutation 'R5353:Phyh'
ID423886
Institutional Source Beutler Lab
Gene Symbol Phyh
Ensembl Gene ENSMUSG00000026664
Gene Namephytanoyl-CoA hydroxylase
SynonymsLnap1
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4919019-4938730 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 4942201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027975]
Predicted Effect probably benign
Transcript: ENSMUST00000027975
SMART Domains Protein: ENSMUSP00000027975
Gene: ENSMUSG00000026664

DomainStartEndE-ValueType
Pfam:PhyH 61 277 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142299
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high phytol diet, mice homozygous for a null allele exhibit hepatic lipidosis and steatosis, ataxia, peripheral neuropathy and loss of spermatogonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Phyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Phyh APN 2 4930793 missense probably null 1.00
R0552:Phyh UTSW 2 4936101 missense probably damaging 1.00
R1624:Phyh UTSW 2 4925683 missense probably benign 0.11
R1656:Phyh UTSW 2 4938353 missense probably damaging 0.97
R1721:Phyh UTSW 2 4937809 missense probably null 0.24
R3161:Phyh UTSW 2 4937671 splice site probably benign
R5907:Phyh UTSW 2 4930651 intron probably null
R6093:Phyh UTSW 2 4919085 missense possibly damaging 0.51
R6188:Phyh UTSW 2 4927490 missense probably damaging 0.96
R6394:Phyh UTSW 2 4936003 missense probably benign 0.02
R7316:Phyh UTSW 2 4936044 nonsense probably null
X0060:Phyh UTSW 2 4938350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGATCCCGGGGTACATTTG -3'
(R):5'- TTAGATCTGCAGTTGGGCTC -3'

Sequencing Primer
(F):5'- TTTAGTGGACAGGTACCTAGCAACC -3'
(R):5'- TTGGGCTCAACGCACTC -3'
Posted On2016-08-04