Incidental Mutation 'R5353:Dock6'
ID423911
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21814786 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1409 (H1409Q)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
AA Change: H1409Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: H1409Q

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184374
Predicted Effect unknown
Transcript: ENSMUST00000215729
AA Change: H173Q
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: H1440Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTTTCAGCACGGCACTCAG -3'
(R):5'- TTCTGACCGTGACATGTGGG -3'

Sequencing Primer
(F):5'- CTTCACGGGTTAGAAATCCATGCG -3'
(R):5'- CATGTGGGCAAGGAAATTCC -3'
Posted On2016-08-04