Incidental Mutation 'R5353:Pik3r4'
ID423916
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105667938 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000186943] [ENSMUST00000191268] [ENSMUST00000191268]
Predicted Effect probably null
Transcript: ENSMUST00000065778
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186943
Predicted Effect probably null
Transcript: ENSMUST00000186943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188385
Predicted Effect probably null
Transcript: ENSMUST00000191268
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191268
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7561:Pik3r4 UTSW 9 105687247 missense possibly damaging 0.94
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7954:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGCACTGAAGGACTTC -3'
(R):5'- TTAGGGATTAGAAGACAGCCCC -3'

Sequencing Primer
(F):5'- CTTCATGATGAAATCAAATCGAGCC -3'
(R):5'- CTCAAGAGGCGCATGGTGTAC -3'
Posted On2016-08-04