Incidental Mutation 'R5353:Nr1d2'
ID 423931
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Name nuclear receptor subfamily 1, group D, member 2
Synonyms Rev-erb beta, RVR
MMRRC Submission 042932-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5353 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 4230569-4265642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18222125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 49 (C49R)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
AlphaFold Q60674
Predicted Effect probably benign
Transcript: ENSMUST00000090543
AA Change: C49R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: C49R

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,934,470 (GRCm39) S649P probably damaging Het
Adam22 C A 5: 8,140,182 (GRCm39) G202W probably damaging Het
Adamts1 T A 16: 85,599,496 (GRCm39) M35L probably benign Het
Adgrg3 A T 8: 95,762,556 (GRCm39) H202L probably damaging Het
Anln G T 9: 22,271,813 (GRCm39) R681S probably damaging Het
Aprt A T 8: 123,302,147 (GRCm39) M1K probably null Het
Arid3b G T 9: 57,702,320 (GRCm39) probably null Het
Cbl A G 9: 44,084,620 (GRCm39) F172L probably damaging Het
Cd109 G T 9: 78,617,521 (GRCm39) V1340L probably damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chrm3 A G 13: 9,928,593 (GRCm39) Y148H probably damaging Het
Cog7 A C 7: 121,540,470 (GRCm39) probably null Het
Cpsf1 A T 15: 76,486,771 (GRCm39) I255N probably damaging Het
Crebzf G A 7: 90,092,622 (GRCm39) G134R probably damaging Het
Crybg1 T C 10: 43,849,661 (GRCm39) S1705G probably damaging Het
Dock6 A T 9: 21,726,082 (GRCm39) H1409Q probably benign Het
Fank1 A G 7: 133,478,632 (GRCm39) D232G probably damaging Het
Fat1 G T 8: 45,489,168 (GRCm39) V3480L probably benign Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Fmn2 G T 1: 174,330,572 (GRCm39) G321W unknown Het
Greb1 A T 12: 16,738,567 (GRCm39) Y1465* probably null Het
Hdac9 G A 12: 34,443,392 (GRCm39) Q330* probably null Het
Kcnt2 C T 1: 140,354,639 (GRCm39) T298I probably damaging Het
Knl1 A G 2: 118,901,464 (GRCm39) D1055G probably benign Het
Mroh2b T C 15: 4,946,660 (GRCm39) S487P probably damaging Het
Naa38 G A 11: 69,287,408 (GRCm39) V110I probably benign Het
Nkd2 T C 13: 73,969,557 (GRCm39) H303R probably damaging Het
Or4c111 A G 2: 88,844,099 (GRCm39) V103A probably benign Het
Or52b2 A G 7: 104,986,324 (GRCm39) Y200H probably damaging Het
Ovch2 T A 7: 107,393,631 (GRCm39) E165V probably damaging Het
Phyh A T 2: 4,947,012 (GRCm39) probably benign Het
Pik3r4 G A 9: 105,545,137 (GRCm39) probably null Het
Ppip5k1 A C 2: 121,142,201 (GRCm39) V1416G probably benign Het
Ppm1b T C 17: 85,301,537 (GRCm39) V139A probably benign Het
Ppp1r12a T G 10: 108,097,077 (GRCm39) probably null Het
Pramel20 A G 4: 143,297,807 (GRCm39) T76A probably benign Het
Psmc5 G T 11: 106,152,327 (GRCm39) A115S probably damaging Het
Ptpn5 T A 7: 46,731,642 (GRCm39) E409V probably benign Het
Ptprg T A 14: 11,554,235 (GRCm38) probably benign Het
Qrich1 G T 9: 108,422,164 (GRCm39) V593F probably damaging Het
Rbbp9 T C 2: 144,385,741 (GRCm39) I175V probably benign Het
Selenot T C 3: 58,493,387 (GRCm39) F88S possibly damaging Het
Sp110 C T 1: 85,516,841 (GRCm39) E219K possibly damaging Het
Spred2 A G 11: 19,968,155 (GRCm39) D208G possibly damaging Het
Surf1 T C 2: 26,804,204 (GRCm39) T197A probably benign Het
Taco1 G A 11: 105,963,539 (GRCm39) probably null Het
Tas2r109 A G 6: 132,957,594 (GRCm39) V112A possibly damaging Het
Tpr C T 1: 150,321,675 (GRCm39) R3C probably damaging Het
Uggt2 A G 14: 119,319,182 (GRCm39) I280T probably benign Het
Yipf2 A G 9: 21,503,228 (GRCm39) Y80H possibly damaging Het
Zscan12 T C 13: 21,548,178 (GRCm39) V120A possibly damaging Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18,215,502 (GRCm38) intron probably benign
IGL00897:Nr1d2 APN 14 18,214,993 (GRCm38) missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18,222,011 (GRCm38) missense probably benign
IGL03039:Nr1d2 APN 14 18,215,184 (GRCm38) missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18,216,703 (GRCm38) missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18,215,403 (GRCm38) missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18,215,502 (GRCm38) intron probably benign
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18,215,086 (GRCm38) missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18,211,891 (GRCm38) missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18,215,504 (GRCm38) splice site probably null
R3738:Nr1d2 UTSW 14 18,211,804 (GRCm38) missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18,215,446 (GRCm38) missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18,215,197 (GRCm38) missense probably benign 0.00
R5384:Nr1d2 UTSW 14 18,211,922 (GRCm38) missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18,206,860 (GRCm38) missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18,222,248 (GRCm38) missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18,216,656 (GRCm38) nonsense probably null
R8268:Nr1d2 UTSW 14 18,216,659 (GRCm38) missense probably damaging 1.00
R8411:Nr1d2 UTSW 14 18,215,031 (GRCm38) missense probably damaging 0.98
R8429:Nr1d2 UTSW 14 18,215,409 (GRCm38) missense probably benign 0.10
R8696:Nr1d2 UTSW 14 18,216,661 (GRCm38) missense probably damaging 1.00
R8912:Nr1d2 UTSW 14 18,220,030 (GRCm38) missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18,211,823 (GRCm38) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AAAGGCCATCTGCATTAGTGAC -3'
(R):5'- TGTGAGCCAGGAATGTACTCAAG -3'

Sequencing Primer
(F):5'- TCACAGGACAATCTGTGC -3'
(R):5'- ACTTTGTAGAGGGAGTAATATGACAC -3'
Posted On 2016-08-04