Incidental Mutation 'R5353:Nr1d2'
ID423931
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Namenuclear receptor subfamily 1, group D, member 2
SynonymsRev-erb beta, RVR
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location18204054-18239127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18222125 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 49 (C49R)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000090543
AA Change: C49R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: C49R

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18215502 intron probably benign
IGL00897:Nr1d2 APN 14 18214993 missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18222011 missense probably benign
IGL03039:Nr1d2 APN 14 18215184 missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18216703 missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18215403 missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18215502 intron probably benign
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18215086 missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18211891 missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18215504 splice site probably null
R3738:Nr1d2 UTSW 14 18211804 missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18215446 missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18215197 missense probably benign 0.00
R5384:Nr1d2 UTSW 14 18211922 missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18206860 missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18222248 missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18216656 nonsense probably null
R8268:Nr1d2 UTSW 14 18216659 missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18211823 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AAAGGCCATCTGCATTAGTGAC -3'
(R):5'- TGTGAGCCAGGAATGTACTCAAG -3'

Sequencing Primer
(F):5'- TCACAGGACAATCTGTGC -3'
(R):5'- ACTTTGTAGAGGGAGTAATATGACAC -3'
Posted On2016-08-04