Incidental Mutation 'R5353:Cdc45'
ID423935
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18795897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably damaging
Transcript: ENSMUST00000000028
AA Change: R251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: R251H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096990
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: R205H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
R7910:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
R7991:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCATGACTCAGACATCGTC -3'
(R):5'- TCTCAGTACCTAAAGATGGGGC -3'

Sequencing Primer
(F):5'- AGGACATGGGTGGTTCTATCAC -3'
(R):5'- CTCAGTACCTAAAGATGGGGCATAGC -3'
Posted On2016-08-04