Incidental Mutation 'R5354:St18'
ID 423940
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission 042933-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5354 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 6557455-6931164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6914395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 782 (A782V)
Ref Sequence ENSEMBL: ENSMUSP00000131417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably damaging
Transcript: ENSMUST00000043578
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131494
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140079
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150761
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151015
Predicted Effect probably damaging
Transcript: ENSMUST00000151281
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163727
AA Change: A782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: A782V

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,436,535 (GRCm39) K196R probably benign Het
Ablim1 T C 19: 57,119,355 (GRCm39) E243G probably benign Het
Acat1 T A 9: 53,500,483 (GRCm39) E271V possibly damaging Het
Aco1 T C 4: 40,180,290 (GRCm39) probably null Het
Adam22 C A 5: 8,140,182 (GRCm39) G202W probably damaging Het
Agbl3 T A 6: 34,791,687 (GRCm39) H596Q probably benign Het
Anxa7 A G 14: 20,514,977 (GRCm39) L177P possibly damaging Het
Atp11a A T 8: 12,856,753 (GRCm39) N48I probably damaging Het
Bcas1 T A 2: 170,191,316 (GRCm39) N492I possibly damaging Het
Bclaf1 A G 10: 20,209,278 (GRCm39) Y498C probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Bod1l A C 5: 41,988,880 (GRCm39) V409G probably damaging Het
Ccdc170 G A 10: 4,484,188 (GRCm39) C338Y probably benign Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Ckap2 A C 8: 22,667,581 (GRCm39) N93K probably damaging Het
Clca3a1 A T 3: 144,442,766 (GRCm39) S759R possibly damaging Het
Coro1c A T 5: 113,984,226 (GRCm39) I347N possibly damaging Het
Cpox A G 16: 58,491,205 (GRCm39) T139A probably damaging Het
Cyp4a12b C A 4: 115,290,661 (GRCm39) probably null Het
Dctn1 T G 6: 83,160,108 (GRCm39) V116G possibly damaging Het
Dhx38 A G 8: 110,282,378 (GRCm39) V683A probably damaging Het
Dnah12 G A 14: 26,496,299 (GRCm39) probably null Het
Dnajb7 T C 15: 81,292,208 (GRCm39) E43G probably damaging Het
Dsc1 A T 18: 20,220,632 (GRCm39) V714E probably damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
Egfem1 T C 3: 29,136,361 (GRCm39) probably null Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Fmo1 T C 1: 162,657,714 (GRCm39) T476A probably benign Het
Gm10237 T C 16: 35,741,099 (GRCm39) noncoding transcript Het
Gm14496 A G 2: 181,642,602 (GRCm39) S758G probably damaging Het
Gpat2 T A 2: 127,270,643 (GRCm39) L97Q probably damaging Het
Gpr162 T C 6: 124,836,600 (GRCm39) D357G probably benign Het
Hax1 A T 3: 89,905,262 (GRCm39) D34E probably damaging Het
Hmgcr C T 13: 96,791,404 (GRCm39) V97M probably benign Het
Hsd3b2 T C 3: 98,619,631 (GRCm39) T105A probably benign Het
Ints1 A G 5: 139,752,183 (GRCm39) probably null Het
Islr T C 9: 58,064,895 (GRCm39) E204G probably damaging Het
Lrrc36 A G 8: 106,151,996 (GRCm39) N60D probably damaging Het
Maf1 T C 15: 76,237,330 (GRCm39) probably benign Het
Mrgprb4 T A 7: 47,848,077 (GRCm39) R284W probably benign Het
Myh4 A T 11: 67,146,551 (GRCm39) N1508I possibly damaging Het
Nufip2 A G 11: 77,577,103 (GRCm39) H17R unknown Het
Oasl1 A T 5: 115,075,055 (GRCm39) I372L probably damaging Het
Or5ae1 T A 7: 84,565,357 (GRCm39) Y123* probably null Het
Or6p1 T C 1: 174,258,252 (GRCm39) L86P probably damaging Het
Pald1 A T 10: 61,184,440 (GRCm39) Y226N probably damaging Het
Pcdhb13 G T 18: 37,577,844 (GRCm39) G741C probably damaging Het
Pcdhga10 A G 18: 37,881,259 (GRCm39) D340G probably damaging Het
Pclo C A 5: 14,728,822 (GRCm39) probably benign Het
Pcsk4 G T 10: 80,159,523 (GRCm39) N416K probably damaging Het
Pde10a C A 17: 9,180,812 (GRCm39) R398S probably damaging Het
Plin1 T A 7: 79,375,469 (GRCm39) T227S possibly damaging Het
Pnpt1 A G 11: 29,104,166 (GRCm39) D542G probably damaging Het
Ppp4r3b T A 11: 29,161,646 (GRCm39) D673E probably benign Het
Prr18 C A 17: 8,559,892 (GRCm39) P16Q probably damaging Het
Psmc3 T A 2: 90,889,698 (GRCm39) Y440N probably damaging Het
Rassf5 T C 1: 131,108,385 (GRCm39) I232V probably benign Het
Rims1 T A 1: 22,577,592 (GRCm39) D218V probably damaging Het
Skint10 T C 4: 112,568,790 (GRCm39) N309S possibly damaging Het
Slc6a1 T C 6: 114,279,584 (GRCm39) M121T possibly damaging Het
Slit3 A G 11: 35,566,740 (GRCm39) D1004G probably damaging Het
Snap91 C T 9: 86,717,177 (GRCm39) V215I possibly damaging Het
Son T C 16: 91,452,627 (GRCm39) L458S probably damaging Het
Synpo A G 18: 60,735,303 (GRCm39) probably null Het
Thbs3 A G 3: 89,128,684 (GRCm39) D458G probably damaging Het
Tpr C T 1: 150,321,675 (GRCm39) R3C probably damaging Het
Trp63 A G 16: 25,503,105 (GRCm39) probably null Het
Vmn1r27 C A 6: 58,192,581 (GRCm39) R141L probably benign Het
Wnk1 T C 6: 119,945,484 (GRCm39) I699V probably benign Het
Xkr6 A G 14: 64,056,353 (GRCm39) D88G possibly damaging Het
Zan A G 5: 137,379,050 (GRCm39) probably benign Het
Zbtb7b T C 3: 89,286,913 (GRCm39) probably benign Het
Zfp618 A T 4: 62,998,265 (GRCm39) D33V probably damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6,872,796 (GRCm39) missense probably benign 0.07
IGL00840:St18 APN 1 6,903,818 (GRCm39) missense probably damaging 1.00
IGL01016:St18 APN 1 6,914,547 (GRCm39) missense probably damaging 0.98
IGL01116:St18 APN 1 6,872,856 (GRCm39) missense probably damaging 0.96
IGL01719:St18 APN 1 6,916,020 (GRCm39) splice site probably benign
IGL01885:St18 APN 1 6,914,596 (GRCm39) critical splice donor site probably null
IGL02486:St18 APN 1 6,890,307 (GRCm39) missense probably damaging 1.00
IGL02611:St18 APN 1 6,839,114 (GRCm39) splice site probably benign
IGL02742:St18 APN 1 6,872,540 (GRCm39) splice site probably benign
IGL02953:St18 APN 1 6,914,337 (GRCm39) splice site probably benign
IGL02999:St18 APN 1 6,887,829 (GRCm39) missense probably benign 0.01
IGL03092:St18 APN 1 6,839,118 (GRCm39) splice site probably benign
Smallish UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
IGL03055:St18 UTSW 1 6,872,959 (GRCm39) missense probably damaging 0.99
R0089:St18 UTSW 1 6,919,172 (GRCm39) missense probably benign 0.02
R0257:St18 UTSW 1 6,890,186 (GRCm39) missense probably benign 0.04
R0383:St18 UTSW 1 6,873,248 (GRCm39) missense probably damaging 1.00
R0588:St18 UTSW 1 6,887,962 (GRCm39) missense probably damaging 0.99
R0989:St18 UTSW 1 6,898,105 (GRCm39) missense probably benign 0.04
R1068:St18 UTSW 1 6,865,786 (GRCm39) missense probably benign 0.01
R1311:St18 UTSW 1 6,915,868 (GRCm39) missense probably damaging 1.00
R1530:St18 UTSW 1 6,915,793 (GRCm39) critical splice acceptor site probably null
R1723:St18 UTSW 1 6,880,909 (GRCm39) splice site probably benign
R1926:St18 UTSW 1 6,872,913 (GRCm39) missense probably benign 0.00
R1927:St18 UTSW 1 6,872,936 (GRCm39) missense probably benign 0.00
R2035:St18 UTSW 1 6,872,552 (GRCm39) missense probably benign 0.00
R2091:St18 UTSW 1 6,898,195 (GRCm39) missense probably benign 0.08
R2139:St18 UTSW 1 6,880,839 (GRCm39) missense possibly damaging 0.85
R2261:St18 UTSW 1 6,915,796 (GRCm39) missense probably damaging 0.96
R2300:St18 UTSW 1 6,925,626 (GRCm39) missense probably damaging 1.00
R2322:St18 UTSW 1 6,914,348 (GRCm39) nonsense probably null
R2846:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 0.96
R3738:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3739:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3772:St18 UTSW 1 6,914,553 (GRCm39) missense probably damaging 1.00
R3805:St18 UTSW 1 6,872,577 (GRCm39) missense probably damaging 1.00
R3953:St18 UTSW 1 6,873,117 (GRCm39) missense probably damaging 0.99
R4034:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R4036:St18 UTSW 1 6,898,010 (GRCm39) missense probably damaging 1.00
R4407:St18 UTSW 1 6,898,061 (GRCm39) missense probably benign 0.29
R4527:St18 UTSW 1 6,925,647 (GRCm39) missense probably damaging 1.00
R4740:St18 UTSW 1 6,887,828 (GRCm39) missense probably benign
R4838:St18 UTSW 1 6,873,129 (GRCm39) missense probably benign 0.01
R5182:St18 UTSW 1 6,887,877 (GRCm39) missense probably benign 0.03
R5186:St18 UTSW 1 6,872,541 (GRCm39) splice site probably null
R5423:St18 UTSW 1 6,872,840 (GRCm39) missense possibly damaging 0.91
R5724:St18 UTSW 1 6,841,174 (GRCm39) missense probably benign 0.13
R6182:St18 UTSW 1 6,914,342 (GRCm39) splice site probably null
R6491:St18 UTSW 1 6,898,209 (GRCm39) nonsense probably null
R6503:St18 UTSW 1 6,865,621 (GRCm39) missense probably damaging 1.00
R7037:St18 UTSW 1 6,873,260 (GRCm39) missense possibly damaging 0.65
R7098:St18 UTSW 1 6,898,066 (GRCm39) missense probably damaging 1.00
R7132:St18 UTSW 1 6,929,351 (GRCm39) missense
R7144:St18 UTSW 1 6,903,818 (GRCm39) missense probably damaging 1.00
R7150:St18 UTSW 1 6,873,243 (GRCm39) missense probably damaging 1.00
R7334:St18 UTSW 1 6,872,783 (GRCm39) missense probably benign 0.00
R7502:St18 UTSW 1 6,898,194 (GRCm39) missense probably benign 0.09
R7729:St18 UTSW 1 6,872,761 (GRCm39) missense probably benign 0.00
R7848:St18 UTSW 1 6,927,669 (GRCm39) critical splice donor site probably null
R8088:St18 UTSW 1 6,898,229 (GRCm39) missense probably benign 0.00
R8299:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
R8338:St18 UTSW 1 6,879,516 (GRCm39) missense probably damaging 1.00
R8690:St18 UTSW 1 6,872,788 (GRCm39) missense probably benign
R8753:St18 UTSW 1 6,916,015 (GRCm39) missense probably damaging 1.00
R8808:St18 UTSW 1 6,880,826 (GRCm39) missense probably damaging 1.00
R8880:St18 UTSW 1 6,865,619 (GRCm39) nonsense probably null
R9055:St18 UTSW 1 6,873,206 (GRCm39) nonsense probably null
R9292:St18 UTSW 1 6,898,106 (GRCm39) missense probably benign 0.32
R9322:St18 UTSW 1 6,865,747 (GRCm39) missense probably benign 0.00
R9530:St18 UTSW 1 6,872,997 (GRCm39) missense probably benign 0.00
R9603:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 1.00
R9611:St18 UTSW 1 6,873,147 (GRCm39) missense probably benign 0.00
R9639:St18 UTSW 1 6,929,246 (GRCm39) missense
R9644:St18 UTSW 1 6,929,276 (GRCm39) missense
R9740:St18 UTSW 1 6,873,287 (GRCm39) nonsense probably null
R9750:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTGTTTCATGCCACCACC -3'
(R):5'- TGGGGTCATTTTGATGCCAC -3'

Sequencing Primer
(F):5'- CTTGAGAGACGGCTCAGTGACTATG -3'
(R):5'- ACCTTTCCTTGCACGAGGG -3'
Posted On 2016-08-04