Mutagenetix > Incidental Mutation

Incidental Mutation 'R5354:Agbl3'

423965

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

042933-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34814752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 596 (H596Q)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: H596Q

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: H596Q

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: H591Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: H591Q

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121220

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.1111

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Ablim1	T	C	19: 57,130,923	E243G	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cpox	A	G	16: 58,670,842	T139A	probably damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dsc1	A	T	18: 20,087,575	V714E	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Pde10a	C	A	17: 8,961,980	R398S	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Slit3	A	G	11: 35,675,913	D1004G	probably damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAGGTTTCCCGTTTTAATAGTC -3'
(R):5'- GTTGACCAAGATAATGCACTTGTG -3'

Sequencing Primer
(F):5'- GGTTTCCCGTTTTAATAGTCTAATGG -3'
(R):5'- ATGCACTTGTGAAAACTTTCCC -3'

Posted On

2016-08-04