Incidental Mutation 'R0488:Znfx1'
ID42397
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0488 (G1)
Quality Score161
Status Validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 167042563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 923 (R923L)
Ref Sequence ENSEMBL: ENSMUSP00000049404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048988] [ENSMUST00000067584] [ENSMUST00000128676] [ENSMUST00000155281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048988
AA Change: R923L

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: R923L

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000067584
AA Change: R59L

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: R59L

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128676
SMART Domains Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 837 1.8e-17 PFAM
Pfam:AAA_19 597 684 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155281
SMART Domains Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 854 1.7e-17 PFAM
Pfam:AAA_19 597 684 3.6e-11 PFAM
Meta Mutation Damage Score 0.8553 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rimklb G A 6: 122,460,975 T103I probably benign Het
Rsg1 A G 4: 141,214,401 D14G probably benign Het
Samd4b T C 7: 28,414,237 Y101C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tubgcp5 T A 7: 55,829,338 S979T probably damaging Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
R7192:Znfx1 UTSW 2 167042190 missense probably benign 0.00
R7426:Znfx1 UTSW 2 167048555 missense probably damaging 1.00
R7431:Znfx1 UTSW 2 167055792 missense probably damaging 1.00
R7473:Znfx1 UTSW 2 167038824 missense probably damaging 1.00
R7593:Znfx1 UTSW 2 167056225 missense probably benign 0.28
R7732:Znfx1 UTSW 2 167042669 missense possibly damaging 0.91
R7835:Znfx1 UTSW 2 167039827 missense probably damaging 1.00
R7918:Znfx1 UTSW 2 167039827 missense probably damaging 1.00
R8154:Znfx1 UTSW 2 167055237 missense probably damaging 1.00
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCTCAAGTGAGCCCTAAAGCG -3'
(R):5'- AGGTAGCCATCCCTTTGTCCTGTG -3'

Sequencing Primer
(F):5'- CTCCAGAGTTTACAGGCCAG -3'
(R):5'- CCTTTGTCCTGTGCTGGG -3'
Posted On2013-05-23