Incidental Mutation 'R5354:Mrgprb4'
ID423973
Institutional Source Beutler Lab
Gene Symbol Mrgprb4
Ensembl Gene ENSMUSG00000070550
Gene NameMAS-related GPR, member B4
SynonymsMrgB4
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48198070-48199288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48198329 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 284 (R284W)
Ref Sequence ENSEMBL: ENSMUSP00000091952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094388]
Predicted Effect probably benign
Transcript: ENSMUST00000094388
AA Change: R284W

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091952
Gene: ENSMUSG00000070550
AA Change: R284W

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 215 6.4e-8 PFAM
Pfam:7tm_1 46 274 7.6e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal with no apparent alterations in the pattern of axonal innervation of the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Mrgprb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Mrgprb4 APN 7 48198901 missense probably benign
IGL02745:Mrgprb4 APN 7 48198358 missense probably damaging 0.97
R0718:Mrgprb4 UTSW 7 48198553 missense probably benign 0.10
R0849:Mrgprb4 UTSW 7 48199120 missense probably benign 0.24
R1526:Mrgprb4 UTSW 7 48198411 nonsense probably null
R2857:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R2859:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R4355:Mrgprb4 UTSW 7 48198701 missense possibly damaging 0.63
R5636:Mrgprb4 UTSW 7 48198470 missense probably benign 0.02
R5715:Mrgprb4 UTSW 7 48199039 missense probably damaging 1.00
R6180:Mrgprb4 UTSW 7 48198826 missense probably damaging 1.00
R6277:Mrgprb4 UTSW 7 48198901 missense probably benign
R7092:Mrgprb4 UTSW 7 48198236 missense probably benign 0.01
R7301:Mrgprb4 UTSW 7 48198758 missense probably damaging 0.99
R7779:Mrgprb4 UTSW 7 48199147 missense probably benign 0.19
Z1088:Mrgprb4 UTSW 7 48198682 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGTCAGTTTCTGTGTAACAAGCTC -3'
(R):5'- CATTGCTCTCACAGTGGTGG -3'

Sequencing Primer
(F):5'- CAGTTTCTGTGTAACAAGCTCATTTC -3'
(R):5'- TCACAGTGGTGGTCTTCATATAC -3'
Posted On2016-08-04