Incidental Mutation 'R5354:Pnpt1'
ID423988
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Namepolyribonucleotide nucleotidyltransferase 1
SynonymsPNPase, polynucleotide phosphorylase, 1200003F12Rik
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29130744-29161828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29154166 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 542 (D542G)
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
PDB Structure
Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000020756
AA Change: D542G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464
AA Change: D542G

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.9296 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29154217 critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29157087 splice site probably benign
IGL01358:Pnpt1 APN 11 29138425 missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29137142 missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29148272 splice site probably benign
IGL01623:Pnpt1 APN 11 29148272 splice site probably benign
IGL01674:Pnpt1 APN 11 29155787 missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29154306 missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29159327 missense possibly damaging 0.71
IGL02222:Pnpt1 APN 11 29130842 missense probably benign 0.00
IGL02616:Pnpt1 APN 11 29135505 splice site probably benign
IGL02859:Pnpt1 APN 11 29138162 missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29156939 missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29132845 missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29156945 critical splice donor site probably null
R1023:Pnpt1 UTSW 11 29141328 splice site probably benign
R1477:Pnpt1 UTSW 11 29137102 missense probably benign 0.14
R1524:Pnpt1 UTSW 11 29130776 missense unknown
R1769:Pnpt1 UTSW 11 29154159 missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29154342 missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1977:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29141679 missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29138174 missense probably benign 0.05
R4346:Pnpt1 UTSW 11 29145478 missense probably damaging 1.00
R4423:Pnpt1 UTSW 11 29153375 intron probably null
R5503:Pnpt1 UTSW 11 29138156 missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29153246 missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29130887 missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29145469 missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29138567 missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29154867 missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29137285 missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29161334 missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29135522 missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29130860 missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29157070 missense probably damaging 0.97
Z1176:Pnpt1 UTSW 11 29145475 missense probably benign 0.00
Z1176:Pnpt1 UTSW 11 29145477 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGTGACAAGCTTTGTGCGATTG -3'
(R):5'- GACTTACCTGACGCTTGTTGG -3'

Sequencing Primer
(F):5'- TGACAAGCTTTGTGCGATTGAACAG -3'
(R):5'- ACGCTTGTTGGATGGCTTCC -3'
Posted On2016-08-04