Incidental Mutation 'R5354:Slit3'
ID423990
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35675913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1004 (D1004G)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect probably damaging
Transcript: ENSMUST00000069837
AA Change: D1004G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: D1004G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Meta Mutation Damage Score 0.2401 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
Bloated UTSW 11 35633952 missense possibly damaging 0.55
Quellung UTSW 11 35651820 critical splice donor site probably null
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
PIT4791001:Slit3 UTSW 11 35661245 missense possibly damaging 0.85
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
R6887:Slit3 UTSW 11 35544806 splice site probably null
R7067:Slit3 UTSW 11 35508230 missense probably benign 0.04
R7150:Slit3 UTSW 11 35570719 missense probably damaging 1.00
R7228:Slit3 UTSW 11 35599418 missense probably damaging 1.00
R7232:Slit3 UTSW 11 35610689 missense possibly damaging 0.87
R7418:Slit3 UTSW 11 35686428 missense possibly damaging 0.64
R7545:Slit3 UTSW 11 35700312 missense possibly damaging 0.52
R7727:Slit3 UTSW 11 35684044 missense probably damaging 1.00
R7820:Slit3 UTSW 11 35700408 missense probably benign 0.23
R8177:Slit3 UTSW 11 35579092 missense probably damaging 0.99
R8179:Slit3 UTSW 11 35664076 missense probably benign 0.31
R8416:Slit3 UTSW 11 35508235 missense probably benign 0.08
R8417:Slit3 UTSW 11 35610611 missense probably damaging 0.99
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Z1176:Slit3 UTSW 11 35707924 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTGTCTCAGACCTCCAGC -3'
(R):5'- TGAGAGCCTTGTGAGTACATTC -3'

Sequencing Primer
(F):5'- TCCAGCCACAAGAGAGACCTG -3'
(R):5'- GAGCCTTGTGAGTACATTCTAAAGTG -3'
Posted On2016-08-04