Mutagenetix > Incidental Mutations

Incidental Mutation 'R5354:Slit3'

423990

Institutional Source

Beutler Lab

Gene Symbol

Slit3

Ensembl Gene

ENSMUSG00000056427

Gene Name

slit guidance ligand 3

Synonyms

Slit1

MMRRC Submission

042933-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.893) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35121224-35708507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35675913 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1004 (D1004G)

Ref Sequence

ENSEMBL: ENSMUSP00000066857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069837]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069837
AA Change: D1004G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: D1004G

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Meta Mutation Damage Score

0.2401

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Ablim1	T	C	19: 57,130,923	E243G	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Agbl3	T	A	6: 34,814,752	H596Q	probably benign	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cpox	A	G	16: 58,670,842	T139A	probably damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dsc1	A	T	18: 20,087,575	V714E	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Pde10a	C	A	17: 8,961,980	R398S	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Slit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00731:Slit3	APN	11	35622154	missense	probably damaging	1.00
IGL01324:Slit3	APN	11	35610702	missense	probably damaging	1.00
IGL01612:Slit3	APN	11	35700384	missense	possibly damaging	0.95
IGL02145:Slit3	APN	11	35629742	missense	probably damaging	0.99
IGL02146:Slit3	APN	11	35234848	missense	possibly damaging	0.71
IGL02430:Slit3	APN	11	35177774	splice site	probably null
IGL02528:Slit3	APN	11	35578974	missense	probably benign
IGL02530:Slit3	APN	11	35708142	makesense	probably null
IGL02640:Slit3	APN	11	35700345	missense	probably benign	0.10
IGL02819:Slit3	APN	11	35171590	missense	possibly damaging	0.71
IGL02839:Slit3	APN	11	35649047	missense	possibly damaging	0.46
IGL03150:Slit3	APN	11	35508257	missense	possibly damaging	0.88
IGL03161:Slit3	APN	11	35700414	missense	probably benign	0.10
IGL03336:Slit3	APN	11	35670101	missense	probably damaging	0.97
Bloated	UTSW	11	35633952	missense	possibly damaging	0.55
Quellung	UTSW	11	35651820	critical splice donor site	probably null
IGL02988:Slit3	UTSW	11	35708063	missense	probably damaging	0.99
PIT4791001:Slit3	UTSW	11	35661245	missense	possibly damaging	0.85
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0334:Slit3	UTSW	11	35579101	missense	probably damaging	0.97
R0385:Slit3	UTSW	11	35700282	missense	probably damaging	0.98
R0840:Slit3	UTSW	11	35623436	splice site	probably benign
R1065:Slit3	UTSW	11	35121635	missense	possibly damaging	0.86
R1364:Slit3	UTSW	11	35670107	missense	probably benign
R1476:Slit3	UTSW	11	35686299	missense	probably damaging	0.97
R1508:Slit3	UTSW	11	35570621	missense	probably damaging	1.00
R1665:Slit3	UTSW	11	35234906	missense	possibly damaging	0.71
R1692:Slit3	UTSW	11	35659344	missense	probably damaging	1.00
R1696:Slit3	UTSW	11	35675923	missense	probably damaging	0.99
R1727:Slit3	UTSW	11	35629832	missense	probably damaging	1.00
R1752:Slit3	UTSW	11	35564653	missense	probably damaging	0.98
R1970:Slit3	UTSW	11	35630841	critical splice acceptor site	probably null
R2077:Slit3	UTSW	11	35544748	missense	possibly damaging	0.88
R2126:Slit3	UTSW	11	35688679	missense	probably damaging	1.00
R2143:Slit3	UTSW	11	35612261	splice site	probably null
R2162:Slit3	UTSW	11	35688682	missense	probably null	1.00
R2873:Slit3	UTSW	11	35544793	nonsense	probably null
R3813:Slit3	UTSW	11	35675979	missense	probably damaging	1.00
R3831:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3832:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3833:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3839:Slit3	UTSW	11	35508237	missense	probably benign	0.10
R4152:Slit3	UTSW	11	35698320	missense	probably damaging	0.98
R4387:Slit3	UTSW	11	35684048	missense	probably benign	0.12
R4795:Slit3	UTSW	11	35651820	critical splice donor site	probably null
R4910:Slit3	UTSW	11	35632722	missense	probably damaging	0.99
R4933:Slit3	UTSW	11	35688593	missense	probably damaging	1.00
R5048:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5106:Slit3	UTSW	11	35612367	missense	probably damaging	1.00
R5138:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5218:Slit3	UTSW	11	35684175	critical splice donor site	probably null
R5338:Slit3	UTSW	11	35622148	missense	probably benign
R5436:Slit3	UTSW	11	35707911	missense	probably benign	0.05
R5896:Slit3	UTSW	11	35708105	missense	probably damaging	0.99
R5933:Slit3	UTSW	11	35629751	missense	probably benign	0.04
R5963:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R5964:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R6125:Slit3	UTSW	11	35570733	critical splice donor site	probably null
R6153:Slit3	UTSW	11	35700483	missense	possibly damaging	0.69
R6484:Slit3	UTSW	11	35661298	missense	probably benign
R6526:Slit3	UTSW	11	35661292	missense	probably benign	0.33
R6797:Slit3	UTSW	11	35633952	missense	possibly damaging	0.55
R6887:Slit3	UTSW	11	35544806	splice site	probably null
R7067:Slit3	UTSW	11	35508230	missense	probably benign	0.04
R7150:Slit3	UTSW	11	35570719	missense	probably damaging	1.00
R7228:Slit3	UTSW	11	35599418	missense	probably damaging	1.00
R7232:Slit3	UTSW	11	35610689	missense	possibly damaging	0.87
R7418:Slit3	UTSW	11	35686428	missense	possibly damaging	0.64
R7545:Slit3	UTSW	11	35700312	missense	possibly damaging	0.52
R7727:Slit3	UTSW	11	35684044	missense	probably damaging	1.00
R7820:Slit3	UTSW	11	35700408	missense	probably benign	0.23
R8177:Slit3	UTSW	11	35579092	missense	probably damaging	0.99
R8179:Slit3	UTSW	11	35664076	missense	probably benign	0.31
R8416:Slit3	UTSW	11	35508235	missense	probably benign	0.08
R8417:Slit3	UTSW	11	35610611	missense	probably damaging	0.99
X0028:Slit3	UTSW	11	35564637	missense	probably damaging	0.99
Z1176:Slit3	UTSW	11	35707924	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTGTCTCAGACCTCCAGC -3'
(R):5'- TGAGAGCCTTGTGAGTACATTC -3'

Sequencing Primer
(F):5'- TCCAGCCACAAGAGAGACCTG -3'
(R):5'- GAGCCTTGTGAGTACATTCTAAAGTG -3'

Posted On

2016-08-04