Incidental Mutation 'R5354:Trp63'
ID424003
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Nametransformation related protein 63
SynonymsTAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location25683763-25892102 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 25684355 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065523] [ENSMUST00000115307] [ENSMUST00000115308] [ENSMUST00000115310]
Predicted Effect probably null
Transcript: ENSMUST00000065523
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115307
SMART Domains Protein: ENSMUSP00000110962
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 200 1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115308
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115310
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4689:Trp63 UTSW 16 25865262 missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5033:Trp63 UTSW 16 25763306 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6029:Trp63 UTSW 16 25868214 missense probably damaging 1.00
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6913:Trp63 UTSW 16 25889168 missense probably damaging 1.00
R6980:Trp63 UTSW 16 25802093 missense probably benign
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7544:Trp63 UTSW 16 25802087 missense probably benign
R7690:Trp63 UTSW 16 25876733 missense unknown
R7743:Trp63 UTSW 16 25882625 missense probably benign 0.05
R7766:Trp63 UTSW 16 25868219 missense probably damaging 0.97
R7792:Trp63 UTSW 16 25868224 missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25889240 missense probably damaging 1.00
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCATTTGACCCTATTGCTTTCAG -3'
(R):5'- CATGGATGTCTTCAAACTTTGTCAC -3'

Sequencing Primer
(F):5'- ATTGCTTTCAGCCTCCTGG -3'
(R):5'- TTATGCTCGCTAAACAAGG -3'
Posted On2016-08-04