Incidental Mutation 'R5354:Pde10a'
ID 424007
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
MMRRC Submission 042933-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5354 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 8744204-9205480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9180812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 398 (R398S)
Ref Sequence ENSEMBL: ENSMUSP00000123216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: R387S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: R467S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: R467S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
AA Change: R183S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: R183S

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: R387S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: R450S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: R450S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115724
AA Change: R521S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: R521S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149440
AA Change: R398S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: R398S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
AA Change: R749S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1027 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,436,535 (GRCm39) K196R probably benign Het
Ablim1 T C 19: 57,119,355 (GRCm39) E243G probably benign Het
Acat1 T A 9: 53,500,483 (GRCm39) E271V possibly damaging Het
Aco1 T C 4: 40,180,290 (GRCm39) probably null Het
Adam22 C A 5: 8,140,182 (GRCm39) G202W probably damaging Het
Agbl3 T A 6: 34,791,687 (GRCm39) H596Q probably benign Het
Anxa7 A G 14: 20,514,977 (GRCm39) L177P possibly damaging Het
Atp11a A T 8: 12,856,753 (GRCm39) N48I probably damaging Het
Bcas1 T A 2: 170,191,316 (GRCm39) N492I possibly damaging Het
Bclaf1 A G 10: 20,209,278 (GRCm39) Y498C probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Bod1l A C 5: 41,988,880 (GRCm39) V409G probably damaging Het
Ccdc170 G A 10: 4,484,188 (GRCm39) C338Y probably benign Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Ckap2 A C 8: 22,667,581 (GRCm39) N93K probably damaging Het
Clca3a1 A T 3: 144,442,766 (GRCm39) S759R possibly damaging Het
Coro1c A T 5: 113,984,226 (GRCm39) I347N possibly damaging Het
Cpox A G 16: 58,491,205 (GRCm39) T139A probably damaging Het
Cyp4a12b C A 4: 115,290,661 (GRCm39) probably null Het
Dctn1 T G 6: 83,160,108 (GRCm39) V116G possibly damaging Het
Dhx38 A G 8: 110,282,378 (GRCm39) V683A probably damaging Het
Dnah12 G A 14: 26,496,299 (GRCm39) probably null Het
Dnajb7 T C 15: 81,292,208 (GRCm39) E43G probably damaging Het
Dsc1 A T 18: 20,220,632 (GRCm39) V714E probably damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
Egfem1 T C 3: 29,136,361 (GRCm39) probably null Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Fmo1 T C 1: 162,657,714 (GRCm39) T476A probably benign Het
Gm10237 T C 16: 35,741,099 (GRCm39) noncoding transcript Het
Gm14496 A G 2: 181,642,602 (GRCm39) S758G probably damaging Het
Gpat2 T A 2: 127,270,643 (GRCm39) L97Q probably damaging Het
Gpr162 T C 6: 124,836,600 (GRCm39) D357G probably benign Het
Hax1 A T 3: 89,905,262 (GRCm39) D34E probably damaging Het
Hmgcr C T 13: 96,791,404 (GRCm39) V97M probably benign Het
Hsd3b2 T C 3: 98,619,631 (GRCm39) T105A probably benign Het
Ints1 A G 5: 139,752,183 (GRCm39) probably null Het
Islr T C 9: 58,064,895 (GRCm39) E204G probably damaging Het
Lrrc36 A G 8: 106,151,996 (GRCm39) N60D probably damaging Het
Maf1 T C 15: 76,237,330 (GRCm39) probably benign Het
Mrgprb4 T A 7: 47,848,077 (GRCm39) R284W probably benign Het
Myh4 A T 11: 67,146,551 (GRCm39) N1508I possibly damaging Het
Nufip2 A G 11: 77,577,103 (GRCm39) H17R unknown Het
Oasl1 A T 5: 115,075,055 (GRCm39) I372L probably damaging Het
Or5ae1 T A 7: 84,565,357 (GRCm39) Y123* probably null Het
Or6p1 T C 1: 174,258,252 (GRCm39) L86P probably damaging Het
Pald1 A T 10: 61,184,440 (GRCm39) Y226N probably damaging Het
Pcdhb13 G T 18: 37,577,844 (GRCm39) G741C probably damaging Het
Pcdhga10 A G 18: 37,881,259 (GRCm39) D340G probably damaging Het
Pclo C A 5: 14,728,822 (GRCm39) probably benign Het
Pcsk4 G T 10: 80,159,523 (GRCm39) N416K probably damaging Het
Plin1 T A 7: 79,375,469 (GRCm39) T227S possibly damaging Het
Pnpt1 A G 11: 29,104,166 (GRCm39) D542G probably damaging Het
Ppp4r3b T A 11: 29,161,646 (GRCm39) D673E probably benign Het
Prr18 C A 17: 8,559,892 (GRCm39) P16Q probably damaging Het
Psmc3 T A 2: 90,889,698 (GRCm39) Y440N probably damaging Het
Rassf5 T C 1: 131,108,385 (GRCm39) I232V probably benign Het
Rims1 T A 1: 22,577,592 (GRCm39) D218V probably damaging Het
Skint10 T C 4: 112,568,790 (GRCm39) N309S possibly damaging Het
Slc6a1 T C 6: 114,279,584 (GRCm39) M121T possibly damaging Het
Slit3 A G 11: 35,566,740 (GRCm39) D1004G probably damaging Het
Snap91 C T 9: 86,717,177 (GRCm39) V215I possibly damaging Het
Son T C 16: 91,452,627 (GRCm39) L458S probably damaging Het
St18 C T 1: 6,914,395 (GRCm39) A782V probably damaging Het
Synpo A G 18: 60,735,303 (GRCm39) probably null Het
Thbs3 A G 3: 89,128,684 (GRCm39) D458G probably damaging Het
Tpr C T 1: 150,321,675 (GRCm39) R3C probably damaging Het
Trp63 A G 16: 25,503,105 (GRCm39) probably null Het
Vmn1r27 C A 6: 58,192,581 (GRCm39) R141L probably benign Het
Wnk1 T C 6: 119,945,484 (GRCm39) I699V probably benign Het
Xkr6 A G 14: 64,056,353 (GRCm39) D88G possibly damaging Het
Zan A G 5: 137,379,050 (GRCm39) probably benign Het
Zbtb7b T C 3: 89,286,913 (GRCm39) probably benign Het
Zfp618 A T 4: 62,998,265 (GRCm39) D33V probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 9,163,802 (GRCm39) missense probably damaging 1.00
IGL01762:Pde10a APN 17 9,161,750 (GRCm39) missense possibly damaging 0.74
IGL01814:Pde10a APN 17 9,147,939 (GRCm39) start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 9,193,601 (GRCm39) missense probably damaging 1.00
IGL02386:Pde10a APN 17 9,172,636 (GRCm39) missense possibly damaging 0.93
IGL02573:Pde10a APN 17 9,180,722 (GRCm39) missense probably benign 0.38
IGL02583:Pde10a APN 17 9,200,462 (GRCm39) missense probably benign 0.23
IGL02649:Pde10a APN 17 9,172,604 (GRCm39) missense probably damaging 1.00
IGL02992:Pde10a APN 17 9,168,293 (GRCm39) missense probably damaging 0.97
IGL03109:Pde10a APN 17 9,148,046 (GRCm39) critical splice donor site probably null
brautigam UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
Bride UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
buzzed UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
Gracile UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
Nubile UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
thunderball UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R0004:Pde10a UTSW 17 9,200,408 (GRCm39) missense probably benign 0.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0650:Pde10a UTSW 17 9,161,797 (GRCm39) missense probably damaging 1.00
R1173:Pde10a UTSW 17 9,139,378 (GRCm39) splice site probably benign
R1386:Pde10a UTSW 17 9,172,574 (GRCm39) missense probably damaging 1.00
R1458:Pde10a UTSW 17 9,183,540 (GRCm39) missense probably damaging 0.98
R1598:Pde10a UTSW 17 9,147,976 (GRCm39) missense probably damaging 1.00
R1661:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1665:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1883:Pde10a UTSW 17 9,197,776 (GRCm39) missense possibly damaging 0.86
R1960:Pde10a UTSW 17 9,161,750 (GRCm39) missense possibly damaging 0.74
R2005:Pde10a UTSW 17 9,147,923 (GRCm39) critical splice acceptor site probably null
R2071:Pde10a UTSW 17 9,180,827 (GRCm39) missense probably benign 0.22
R2121:Pde10a UTSW 17 9,196,047 (GRCm39) missense probably damaging 1.00
R2376:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R3721:Pde10a UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R3872:Pde10a UTSW 17 8,975,923 (GRCm39) missense possibly damaging 0.92
R4627:Pde10a UTSW 17 9,200,484 (GRCm39) missense probably damaging 1.00
R4652:Pde10a UTSW 17 8,975,885 (GRCm39) missense possibly damaging 0.82
R5107:Pde10a UTSW 17 9,163,802 (GRCm39) missense probably damaging 1.00
R5184:Pde10a UTSW 17 9,195,987 (GRCm39) missense probably damaging 1.00
R5735:Pde10a UTSW 17 9,160,024 (GRCm39) missense probably damaging 0.99
R5878:Pde10a UTSW 17 9,168,204 (GRCm39) missense possibly damaging 0.85
R5921:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R6027:Pde10a UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
R6145:Pde10a UTSW 17 9,147,949 (GRCm39) missense probably damaging 1.00
R6279:Pde10a UTSW 17 9,197,789 (GRCm39) missense probably damaging 0.99
R6409:Pde10a UTSW 17 9,168,270 (GRCm39) missense probably damaging 1.00
R6870:Pde10a UTSW 17 9,186,356 (GRCm39) missense possibly damaging 0.56
R6947:Pde10a UTSW 17 9,188,424 (GRCm39) missense probably damaging 1.00
R7072:Pde10a UTSW 17 9,161,858 (GRCm39) missense probably benign 0.40
R7084:Pde10a UTSW 17 9,159,994 (GRCm39) missense probably benign 0.25
R7294:Pde10a UTSW 17 8,975,853 (GRCm39) missense probably benign
R7339:Pde10a UTSW 17 8,975,860 (GRCm39) missense probably benign 0.01
R7347:Pde10a UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
R7373:Pde10a UTSW 17 9,161,824 (GRCm39) missense probably benign 0.00
R7481:Pde10a UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
R7833:Pde10a UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
R7923:Pde10a UTSW 17 9,147,964 (GRCm39) missense probably benign 0.40
R8053:Pde10a UTSW 17 9,193,604 (GRCm39) missense probably benign 0.12
R8137:Pde10a UTSW 17 9,193,647 (GRCm39) missense possibly damaging 0.90
R8722:Pde10a UTSW 17 9,163,772 (GRCm39) missense probably benign 0.01
R8918:Pde10a UTSW 17 9,160,063 (GRCm39) missense possibly damaging 0.65
R8973:Pde10a UTSW 17 9,143,071 (GRCm39) missense probably benign
R9113:Pde10a UTSW 17 9,197,782 (GRCm39) missense probably benign
R9163:Pde10a UTSW 17 9,181,791 (GRCm39) missense possibly damaging 0.89
R9275:Pde10a UTSW 17 9,200,488 (GRCm39) makesense probably null
R9563:Pde10a UTSW 17 9,020,710 (GRCm39) missense unknown
R9641:Pde10a UTSW 17 9,197,816 (GRCm39) missense
R9660:Pde10a UTSW 17 9,170,370 (GRCm39) missense probably damaging 0.99
R9670:Pde10a UTSW 17 9,020,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCCCTATTGTTCTAAGGAGGC -3'
(R):5'- TACACCCTGGCTGGTCTTTG -3'

Sequencing Primer
(F):5'- GTTCTAAGGAGGCCCCATTCAC -3'
(R):5'- CCATCCTGGGCTTGATCAG -3'
Posted On 2016-08-04