Mutagenetix > Incidental Mutation

Incidental Mutation 'R5354:Pde10a'

424007

Institutional Source

Beutler Lab

Gene Symbol

Pde10a

Ensembl Gene

ENSMUSG00000023868

Gene Name

phosphodiesterase 10A

Synonyms

MMRRC Submission

042933-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8525372-8986648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 8961980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 398 (R398S)

Ref Sequence

ENSEMBL: ENSMUSP00000123216 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024647
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: R387S

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000089085
AA Change: R467S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: R467S

Domain	Start	End	E-Value	Type
GAF	101	254	1.44e-3	SMART
GAF	276	432	6.56e-29	SMART
HDc	522	688	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115708
AA Change: R183S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: R183S

Domain	Start	End	E-Value	Type
GAF	3	148	5.22e-23	SMART
HDc	238	404	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115715
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: R387S

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115717

Predicted Effect

probably benign
Transcript: ENSMUST00000115720
AA Change: R450S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: R450S

Domain	Start	End	E-Value	Type
GAF	84	237	1.44e-3	SMART
GAF	259	415	6.56e-29	SMART
HDc	505	671	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115724
AA Change: R521S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: R521S

Domain	Start	End	E-Value	Type
GAF	95	248	1.44e-3	SMART
GAF	270	426	6.56e-29	SMART
HDc	516	682	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000149440
AA Change: R398S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: R398S

Domain	Start	End	E-Value	Type
GAF	32	185	1.44e-3	SMART
GAF	207	363	6.56e-29	SMART
HDc	453	619	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000231430
AA Change: R749S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.1027

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Ablim1	T	C	19: 57,130,923	E243G	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Agbl3	T	A	6: 34,814,752	H596Q	probably benign	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cpox	A	G	16: 58,670,842	T139A	probably damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dsc1	A	T	18: 20,087,575	V714E	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Slit3	A	G	11: 35,675,913	D1004G	probably damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Pde10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:Pde10a	APN	17	8944970	missense	probably damaging	1.00
IGL01762:Pde10a	APN	17	8942918	missense	possibly damaging	0.74
IGL01814:Pde10a	APN	17	8929107	start codon destroyed	probably null	0.00
IGL02053:Pde10a	APN	17	8974769	missense	probably damaging	1.00
IGL02386:Pde10a	APN	17	8953804	missense	possibly damaging	0.93
IGL02573:Pde10a	APN	17	8961890	missense	probably benign	0.38
IGL02583:Pde10a	APN	17	8981630	missense	probably benign	0.23
IGL02649:Pde10a	APN	17	8953772	missense	probably damaging	1.00
IGL02992:Pde10a	APN	17	8949461	missense	probably damaging	0.97
IGL03109:Pde10a	APN	17	8929214	critical splice donor site	probably null
brautigam	UTSW	17	8964677	missense	possibly damaging	0.78
Bride	UTSW	17	8949430	missense	possibly damaging	0.60
buzzed	UTSW	17	8930537	missense	probably damaging	1.00
Gracile	UTSW	17	8961920	missense	possibly damaging	0.63
Nubile	UTSW	17	8967462	missense	probably damaging	1.00
thunderball	UTSW	17	8969589	missense	probably damaging	1.00
R0004:Pde10a	UTSW	17	8981576	missense	probably benign	0.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0650:Pde10a	UTSW	17	8942965	missense	probably damaging	1.00
R1173:Pde10a	UTSW	17	8920546	splice site	probably benign
R1386:Pde10a	UTSW	17	8953742	missense	probably damaging	1.00
R1458:Pde10a	UTSW	17	8964708	missense	probably damaging	0.98
R1598:Pde10a	UTSW	17	8929144	missense	probably damaging	1.00
R1661:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1665:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1883:Pde10a	UTSW	17	8978944	missense	possibly damaging	0.86
R1960:Pde10a	UTSW	17	8942918	missense	possibly damaging	0.74
R2005:Pde10a	UTSW	17	8929091	critical splice acceptor site	probably null
R2071:Pde10a	UTSW	17	8961995	missense	probably benign	0.22
R2121:Pde10a	UTSW	17	8977215	missense	probably damaging	1.00
R2376:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R3721:Pde10a	UTSW	17	8969589	missense	probably damaging	1.00
R3872:Pde10a	UTSW	17	8757091	missense	possibly damaging	0.92
R4627:Pde10a	UTSW	17	8981652	missense	probably damaging	1.00
R4652:Pde10a	UTSW	17	8757053	missense	possibly damaging	0.82
R5107:Pde10a	UTSW	17	8944970	missense	probably damaging	1.00
R5184:Pde10a	UTSW	17	8977155	missense	probably damaging	1.00
R5735:Pde10a	UTSW	17	8941192	missense	probably damaging	0.99
R5878:Pde10a	UTSW	17	8949372	missense	possibly damaging	0.85
R5921:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R6027:Pde10a	UTSW	17	8964677	missense	possibly damaging	0.78
R6145:Pde10a	UTSW	17	8929117	missense	probably damaging	1.00
R6279:Pde10a	UTSW	17	8978957	missense	probably damaging	0.99
R6409:Pde10a	UTSW	17	8949438	missense	probably damaging	1.00
R6870:Pde10a	UTSW	17	8967524	missense	possibly damaging	0.56
R6947:Pde10a	UTSW	17	8969592	missense	probably damaging	1.00
R7072:Pde10a	UTSW	17	8943026	missense	probably benign	0.40
R7084:Pde10a	UTSW	17	8941162	missense	probably benign	0.25
R7294:Pde10a	UTSW	17	8757021	missense	probably benign
R7339:Pde10a	UTSW	17	8757028	missense	probably benign	0.01
R7347:Pde10a	UTSW	17	8967462	missense	probably damaging	1.00
R7373:Pde10a	UTSW	17	8942992	missense	probably benign	0.00
R7481:Pde10a	UTSW	17	8949430	missense	possibly damaging	0.60
R7833:Pde10a	UTSW	17	8961920	missense	possibly damaging	0.63
R7923:Pde10a	UTSW	17	8929132	missense	probably benign	0.40
R8053:Pde10a	UTSW	17	8974772	missense	probably benign	0.12
R8137:Pde10a	UTSW	17	8974815	missense	possibly damaging	0.90
R8722:Pde10a	UTSW	17	8944940	missense	probably benign	0.01
R8918:Pde10a	UTSW	17	8941231	missense	possibly damaging	0.65
R8973:Pde10a	UTSW	17	8924239	missense	probably benign
R9113:Pde10a	UTSW	17	8978950	missense	probably benign
R9163:Pde10a	UTSW	17	8962959	missense	possibly damaging	0.89
R9275:Pde10a	UTSW	17	8981656	makesense	probably null
R9563:Pde10a	UTSW	17	8801878	missense	unknown
R9641:Pde10a	UTSW	17	8978984	missense
R9660:Pde10a	UTSW	17	8951538	missense	probably damaging	0.99
R9670:Pde10a	UTSW	17	8801440	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCCCTATTGTTCTAAGGAGGC -3'
(R):5'- TACACCCTGGCTGGTCTTTG -3'

Sequencing Primer
(F):5'- GTTCTAAGGAGGCCCCATTCAC -3'
(R):5'- CCATCCTGGGCTTGATCAG -3'

Posted On

2016-08-04