Incidental Mutation 'R5354:Pde10a'
ID424007
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8961980 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 398 (R398S)
Ref Sequence ENSEMBL: ENSMUSP00000123216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: R387S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: R467S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: R467S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
AA Change: R183S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: R183S

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
AA Change: R387S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: R387S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: R450S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: R450S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115724
AA Change: R521S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: R521S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149440
AA Change: R398S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: R398S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
AA Change: R749S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1027 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
brautigam UTSW 17 8964677 missense possibly damaging 0.78
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCCTATTGTTCTAAGGAGGC -3'
(R):5'- TACACCCTGGCTGGTCTTTG -3'

Sequencing Primer
(F):5'- GTTCTAAGGAGGCCCCATTCAC -3'
(R):5'- CCATCCTGGGCTTGATCAG -3'
Posted On2016-08-04