Mutagenetix > Incidental Mutations

Incidental Mutation 'R5354:Dsc1'

424009

Institutional Source

Beutler Lab

Gene Symbol

Dsc1

Ensembl Gene

ENSMUSG00000044322

Gene Name

desmocollin 1

Synonyms

Dsc1a, Dsc1b

MMRRC Submission

042933-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20084184-20114871 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20087575 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 714 (V714E)

Ref Sequence

ENSEMBL: ENSMUSP00000153639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038710
AA Change: V714E

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: V714E

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
Cadherin_pro	29	111	2.61e-41	SMART
CA	155	240	2.78e-9	SMART
CA	264	352	5.94e-27	SMART
CA	375	470	5.27e-10	SMART
CA	493	575	1.18e-21	SMART
Blast:CA	593	672	5e-46	BLAST
transmembrane domain	692	714	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224432
AA Change: V714E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224557

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Ablim1	T	C	19: 57,130,923	E243G	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Agbl3	T	A	6: 34,814,752	H596Q	probably benign	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cpox	A	G	16: 58,670,842	T139A	probably damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Pde10a	C	A	17: 8,961,980	R398S	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Slit3	A	G	11: 35,675,913	D1004G	probably damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Dsc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Dsc1	APN	18	20101886	missense	probably damaging	1.00
IGL00571:Dsc1	APN	18	20110138	missense	probably damaging	1.00
IGL00790:Dsc1	APN	18	20094896	missense	probably damaging	1.00
IGL00963:Dsc1	APN	18	20111986	missense	probably null	0.01
IGL00972:Dsc1	APN	18	20088363	missense	probably benign	0.32
IGL01112:Dsc1	APN	18	20094622	missense	probably benign	0.02
IGL01458:Dsc1	APN	18	20099138	missense	probably damaging	1.00
IGL01607:Dsc1	APN	18	20089663	missense	probably damaging	1.00
IGL01794:Dsc1	APN	18	20110183	missense	probably damaging	1.00
IGL01959:Dsc1	APN	18	20097225	missense	probably damaging	1.00
IGL02066:Dsc1	APN	18	20108803	unclassified	probably benign
IGL02365:Dsc1	APN	18	20108816	missense	probably damaging	1.00
IGL02714:Dsc1	APN	18	20087485	missense	probably damaging	1.00
IGL02959:Dsc1	APN	18	20108885	missense	probably damaging	1.00
IGL03019:Dsc1	APN	18	20088364	missense	probably benign	0.00
IGL03106:Dsc1	APN	18	20086644	splice site	probably null
R0414:Dsc1	UTSW	18	20088354	missense	possibly damaging	0.85
R0456:Dsc1	UTSW	18	20099112	missense	probably damaging	1.00
R0612:Dsc1	UTSW	18	20114516	missense	probably damaging	0.96
R0630:Dsc1	UTSW	18	20085862	missense	probably damaging	1.00
R0646:Dsc1	UTSW	18	20096057	missense	probably damaging	1.00
R0928:Dsc1	UTSW	18	20110249	splice site	probably null
R0976:Dsc1	UTSW	18	20095041	splice site	probably null
R1221:Dsc1	UTSW	18	20114542	nonsense	probably null
R1398:Dsc1	UTSW	18	20088336	missense	probably damaging	1.00
R1902:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R1903:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R2070:Dsc1	UTSW	18	20088296	splice site	probably null
R2119:Dsc1	UTSW	18	20110152	missense	probably benign	0.07
R3935:Dsc1	UTSW	18	20097241	missense	probably benign	0.00
R4747:Dsc1	UTSW	18	20094558	missense	probably damaging	1.00
R5034:Dsc1	UTSW	18	20095027	missense	possibly damaging	0.91
R5243:Dsc1	UTSW	18	20099159	missense	probably damaging	1.00
R5289:Dsc1	UTSW	18	20101853	missense	possibly damaging	0.72
R5300:Dsc1	UTSW	18	20094860	missense	probably damaging	1.00
R5376:Dsc1	UTSW	18	20088446	missense	probably benign	0.21
R5808:Dsc1	UTSW	18	20086829	nonsense	probably null
R5860:Dsc1	UTSW	18	20095024	missense	probably damaging	1.00
R6059:Dsc1	UTSW	18	20110242	missense	probably damaging	0.98
R6116:Dsc1	UTSW	18	20097299	missense	probably benign	0.10
R6351:Dsc1	UTSW	18	20086769	missense	probably damaging	1.00
R6422:Dsc1	UTSW	18	20095033	missense	probably damaging	1.00
R6811:Dsc1	UTSW	18	20089654	missense	probably benign
R6880:Dsc1	UTSW	18	20088372	missense	probably damaging	0.99
R6941:Dsc1	UTSW	18	20097189	missense	probably benign	0.00
R6997:Dsc1	UTSW	18	20086644	splice site	probably null
R7255:Dsc1	UTSW	18	20097273	missense	probably benign	0.12
R7456:Dsc1	UTSW	18	20086822	missense	probably benign	0.00
R7492:Dsc1	UTSW	18	20107680	missense	possibly damaging	0.46
R7503:Dsc1	UTSW	18	20085865	missense	probably damaging	1.00
R8030:Dsc1	UTSW	18	20089571	missense	probably benign
R8167:Dsc1	UTSW	18	20097201	missense	probably damaging	1.00
R8444:Dsc1	UTSW	18	20089579	missense	probably benign	0.00
Z1176:Dsc1	UTSW	18	20114538	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TGCAGGGAACTTTGATTTCTGC -3'
(R):5'- TCCTCAGAAGTTAATCATGAGACAG -3'

Sequencing Primer
(F):5'- ATTTCTGCTTGGTGCTATATGGATC -3'
(R):5'- AATCATGAGACAGTGAAGATTTCTG -3'

Posted On

2016-08-04