Incidental Mutation 'R0488:Snrnp40'
ID 42401
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms 0610009C03Rik, Wdr57
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0488 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 130360132-130390026 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 130378043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
AlphaFold Q6PE01
Predicted Effect probably null
Transcript: ENSMUST00000105994
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rimklb G A 6: 122,460,975 T103I probably benign Het
Rsg1 A G 4: 141,214,401 D14G probably benign Het
Samd4b T C 7: 28,414,237 Y101C probably damaging Het
Tubgcp5 T A 7: 55,829,338 S979T probably damaging Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Znfx1 C A 2: 167,042,563 R923L possibly damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130384523 missense possibly damaging 0.49
R9319:Snrnp40 UTSW 4 130362752 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACATGGTCCTCTTTCTTGAACAACCAG -3'
(R):5'- GCATTAAGTGCCAACCTCCTGCAATC -3'

Sequencing Primer
(F):5'- GAAACCAGAAGAGGGAGTCAG -3'
(R):5'- TCCTGCAATCTCAACATTTAAAAAAG -3'
Posted On 2013-05-23